traci
Uploaded by
29 SLIDES
369 VIEWS
290LIKES

Exploring Human Population Genomics: From Migrations to Sequencing

DESCRIPTION

Delve into the fascinating realm of human population genomics, tracing migrations, genetic origins, and sequencing advancements. Uncover the enigmatic links between human populations, genetic variations, and evolutionary landmarks. Get insights into costs, applications, and the future of genetic sequencing.

1 / 29

Download Presentation

Exploring Human Population Genomics: From Migrations to Sequencing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Introduction: Human Population Genomics

  2. How soon will we all be sequenced? • Cost • Killer apps • Roadblocks? Applications Cost Time 2013? 2018?

  3. The Hominid Lineage

  4. Human population migrations • Out of Africa, Replacement • Single mother of all humans (Eve) ~150,000yr • Single father of all humans (Adam) ~70,000yr • Humans out of Africa ~50000 years ago replaced others (e.g., Neandertals) • Multiregional Evolution • Generally debunked, however, • ~5% of human genome in Europeans, Asians is Neanderthal, Denisova

  5. Coalescence Y-chromosome coalescence

  6. Why humans are so similar A small population that interbred reduced the genetic variation Out of Africa ~ 50,000 years ago Out of Africa

  7. Migration of Humans

  8. Migration of Humans http://info.med.yale.edu/genetics/kkidd/point.html

  9. Migration of Humans http://info.med.yale.edu/genetics/kkidd/point.html

  10. Some Key Definitions Mary: AGCCCGTACG John: AGCCCGTACG Josh: AGCCCGTACG Kate: AGCCCGTACG Pete: AGCCCGTACG Anne: AGCCCGTACG Mimi: AGCCCGTACG Mike: AGCCCTTACG Olga: AGCCCTTACG Tony: AGCCCTTACG G/G G/G G/T G/G G/G G/G G/G T/T T/G T/G Mom Dad Recombinations: At least 1/chromosome On average ~1/100 Mb • Heterozygosity: • Prob[2 alleles picked at random with replacement are different] • 2*.75*.25 = .375 • H = 4Nu/(1+4Nu) Alleles: G, T Major Allele: G Minor Allele: T Linkage Disequilibrium: The degree of correlation between two SNP locations

  11. Human Genome Variation TGCTGAGA TGCCGAGA TGCTCGGAGA TGC - - - GAGA SNP Novel Sequence Mobile Element or Pseudogene Insertion Inversion Translocation Tandem Duplication TGC - - AGA TGCCGAGA Microdeletion Transposition TGC Novel Sequence at Breakpoint Large Deletion

  12. The Fall in Heterozygosity H – HPOP FST= ------------- H

  13. The HapMap Project ASW African ancestry in Southwest USA 90 CEU Northern and Western Europeans (Utah) 180 CHB Han Chinese in Beijing, China 90 CHD Chinese in Metropolitan Denver 100 GIH Gujarati Indians in Houston, Texas 100 JPT Japanese in Tokyo, Japan 91 LWK Luhyain Webuye, Kenya 100 MXL Mexican ancestry in Los Angeles 90 MKK Maasaiin Kinyawa, Kenya 180 TSI Toscaniin Italia 100 YRI Yoruba in Ibadan, Nigeria 100 Genotyping: Probe a limited number (~1M) of known highly variable positions of the human genome

  14. Linkage Disequilibrium & Haplotype Blocks Minor allele: A G pA pG Linkage Disequilibrium (LD): D = P(A and G) - pApG

  15. Population Sequencing – 1000 Genomes Project The 1000 Genomes Project Consortium et al.Nature467, 1061-1173 (2010) doi:10.1038/nature09534

  16. Association Studies Control A/G A/G G/G G/G A/G G/G G/G Disease A/A A/G A/A A/G A/G A/A A/A p-value

  17. Wellcome Trust Case Control Many associations of small effect sizes (<1.5) Nature 464, 713-720(1 April 2010) Nature 447, 661-678(7 June 2007)

  18. Disease Clustering PLoS Genet 5(12): e1000792. doi:10.1371/journal.pgen.1000792. 2009. 

  19. Disease Clustering • RA vs. ATD • RA vs. MS • No recorded co-occurrence of RA and MS

  20. Heritability & Environment Bienvenu OJ, Davydow DS, & Kendler KS (2011).  Psychological medicine, 41 (1), 33-40 PMID:

  21. Ancestry Inference Danish ? French Spanish Mexican

  22. Global Ancestry Inference Nature. 2008 November 6; 456(7218): 98–101.

  23. Ancestry Painting Danish ? French Spanish Mexican

  24. Ancestry Painting – Haplotype-based HAPAA, HAPMIX HAPAA: Genome Res. 2008. 18: 676-682 HAPMIX: PLoSGenet 5(6): e1000519, 2009

  25. Fixation, Positive & Negative Selection How can we detect negative selection? How can we detect positive selection? Negative Selection Neutral Drift Positive Selection

  26. Conservation and Human SNPs Neutral CNS CNSs have fewer SNPs SNPs have shifted allele frequency spectra

  27. How can we detect positive selection? Ka/Ks ratio: Ratio of nonsynonymous to synonymous substitutions Very old, persistent, strong positive selection for a protein that keeps adapting Examples: immune response, spermatogenesis

  28. How can we detect positive selection?

  29. Long Haplotypes –iHS test • Less time: • Fewer mutations • Fewer recombinations

More Related