slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
010101100010010100001010101010011011100110001100101000100101 PowerPoint Presentation
Download Presentation
010101100010010100001010101010011011100110001100101000100101

Loading in 2 Seconds...

play fullscreen
1 / 29

010101100010010100001010101010011011100110001100101000100101 - PowerPoint PPT Presentation


  • 65 Views
  • Uploaded on

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG. 010101100010010100001010101010011011100110001100101000100101. Introduction: Human Population Genomics. How soon will we all be sequenced?. Cost Killer apps Roadblocks?. Applications. Cost. Time. 2013? 2018?.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '010101100010010100001010101010011011100110001100101000100101' - traci


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG

010101100010010100001010101010011011100110001100101000100101

Introduction: Human Population Genomics

how soon will we all be sequenced
How soon will we all be sequenced?
  • Cost
  • Killer apps
  • Roadblocks?

Applications

Cost

Time

2013?

2018?

human population migrations
Human population migrations
  • Out of Africa, Replacement
    • Single mother of all humans (Eve) ~150,000yr
    • Single father of all humans (Adam) ~70,000yr
    • Humans out of Africa ~50000 years ago replaced others (e.g., Neandertals)
  • Multiregional Evolution
    • Generally debunked, however,
    • ~5% of human genome in Europeans, Asians is Neanderthal, Denisova
coalescence
Coalescence

Y-chromosome coalescence

why humans are so similar
Why humans are so similar

A small population that interbred reduced the genetic variation

Out of Africa ~ 50,000 years ago

Out of Africa

migration of humans1
Migration of Humans

http://info.med.yale.edu/genetics/kkidd/point.html

migration of humans2
Migration of Humans

http://info.med.yale.edu/genetics/kkidd/point.html

some key definitions
Some Key Definitions

Mary: AGCCCGTACG

John: AGCCCGTACG

Josh: AGCCCGTACG

Kate: AGCCCGTACG

Pete: AGCCCGTACG

Anne: AGCCCGTACG

Mimi: AGCCCGTACG

Mike: AGCCCTTACG

Olga: AGCCCTTACG

Tony: AGCCCTTACG

G/G

G/G

G/T

G/G

G/G

G/G

G/G

T/T

T/G

T/G

Mom

Dad

Recombinations:

At least 1/chromosome

On average ~1/100 Mb

  • Heterozygosity:
  • Prob[2 alleles picked at random with replacement are different]
      • 2*.75*.25 = .375
  • H = 4Nu/(1+4Nu)

Alleles: G, T

Major Allele: G

Minor Allele: T

Linkage Disequilibrium:

The degree of correlation between two SNP locations

human genome variation
Human Genome Variation

TGCTGAGA

TGCCGAGA

TGCTCGGAGA

TGC - - - GAGA

SNP

Novel Sequence

Mobile Element or

Pseudogene Insertion

Inversion

Translocation

Tandem Duplication

TGC - - AGA

TGCCGAGA

Microdeletion

Transposition

TGC

Novel Sequence

at Breakpoint

Large Deletion

the fall in heterozygosity
The Fall in Heterozygosity

H – HPOP

FST= -------------

H

the hapmap project
The HapMap Project

ASW African ancestry in Southwest USA 90

CEU Northern and Western Europeans (Utah) 180

CHB Han Chinese in Beijing, China 90

CHD Chinese in Metropolitan Denver 100

GIH Gujarati Indians in Houston, Texas 100

JPT Japanese in Tokyo, Japan 91

LWK Luhyain Webuye, Kenya 100

MXL Mexican ancestry in Los Angeles 90

MKK Maasaiin Kinyawa, Kenya 180

TSI Toscaniin Italia 100

YRI Yoruba in Ibadan, Nigeria 100

Genotyping:

Probe a limited number (~1M) of known highly variable positions of the human genome

linkage disequilibrium haplotype blocks
Linkage Disequilibrium & Haplotype Blocks

Minor allele: A G

pA

pG

Linkage Disequilibrium (LD):

D = P(A and G) - pApG

population sequencing 1000 genomes project
Population Sequencing – 1000 Genomes Project

The 1000 Genomes Project Consortium et al.Nature467, 1061-1173 (2010) doi:10.1038/nature09534

association studies
Association Studies

Control

A/G

A/G

G/G

G/G

A/G

G/G

G/G

Disease

A/A

A/G

A/A

A/G

A/G

A/A

A/A

p-value

wellcome trust case control
Wellcome Trust Case Control

Many associations of small effect sizes (<1.5)

Nature 464, 713-720(1 April 2010)

Nature 447, 661-678(7 June 2007)

disease clustering
Disease Clustering

PLoS Genet 5(12): e1000792. doi:10.1371/journal.pgen.1000792. 2009. 

disease clustering1
Disease Clustering
  • RA vs. ATD
  • RA vs. MS
    • No recorded co-occurrence of RA and MS
heritability environment
Heritability & Environment

Bienvenu OJ, Davydow DS, & Kendler KS (2011).  Psychological medicine, 41 (1), 33-40 PMID:

ancestry inference
Ancestry Inference

Danish

?

French

Spanish

Mexican

global ancestry inference
Global Ancestry Inference

Nature. 2008 November 6; 456(7218): 98–101.

ancestry painting
Ancestry Painting

Danish

?

French

Spanish

Mexican

ancestry painting haplotype based
Ancestry Painting – Haplotype-based

HAPAA, HAPMIX

HAPAA: Genome Res. 2008. 18: 676-682

HAPMIX: PLoSGenet 5(6): e1000519, 2009

fixation positive negative selection
Fixation, Positive & Negative Selection

How can we detect negative selection?

How can we detect positive selection?

Negative Selection

Neutral Drift

Positive Selection

conservation and human snps
Conservation and Human SNPs

Neutral

CNS

CNSs have fewer SNPs

SNPs have shifted allele frequency spectra

how can we detect positive selection
How can we detect positive selection?

Ka/Ks ratio:

Ratio of nonsynonymous to

synonymous substitutions

Very old, persistent, strong positive selection for a protein that keeps adapting

Examples: immune response, spermatogenesis

long haplotypes ihs test
Long Haplotypes –iHS test
  • Less time:
  • Fewer mutations
  • Fewer recombinations