Цепи, концы и направления
Download
1 / 14

????, ????? ? ??????????? - PowerPoint PPT Presentation


  • 129 Views
  • Uploaded on

Цепи, концы и направления. Одноцепочечная ДНК. 5 ’. 5 ’. Цепи, концы и направления. 5 ’. 3 ’. 3 ’. 5 ’. Ген. Белок. N. C. Какая цепь кодирующая ?. 3 ’. ДНК. РНК-полимераза. Рибосома. РНК. 5 ’. Сопряжение процессов транскрипции и трансляции у прокариот. Белок. N.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '????, ????? ? ???????????' - thalia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Цепи, концы и направления

Одноцепочечная ДНК

5’

5’


Цепи, концы и направления

5’

3’

3’

5’

Ген

Белок

N

C

Какая цепь кодирующая ?


3

ДНК

РНК-полимераза

Рибосома

РНК

5’

Сопряжение процессов транскрипции и трансляции у прокариот

Белок

N


Библиотеки на основе К-ДНК

Особенность № 1 - это библиотеки экспрессирующихся областей генома

Геномная библиотека

К-ДНКовая библиотека


АААААА

5’

АААААА

ТТТТТТ

ТТТТТТ

ТТТТТТ

ТТТТТТ

АААААА

АААААА

АААААА

М-РНК

Конструирование библиотеки К-ДНК

Очистка м-РНК

Суммарная РНК

Элюция

Копирование

Проскок


AAAAA

AAAAA

5’

5’

3’

3’

TTTTT

TTTTT

3’

3’

5’

5’

Затравка

Затравка

ДНК-полимераза

3’OH

Конструирование библиотеки К-ДНК

Получение к-ДНК

мРНК

ДНК

Ревертаза

Как получить вторую цепь ДНК?

S1 нуклеаза

Клонирование


5

3’

C

D

Кальцитонин

РКП

A

B

A

B

C

D

Кальцитонин

A

B

C

D

РКП

Прерывистость генов эукариот

Альтернативный сплайсинг

ДНК

Транскрипция

5’

3’

мРНК

C

D

Кальцитонин

РКП

A

B

Сплайсинг

Щитовидная железа

Гипоталамус

Трансляция Процессинг

Трансляция Процессинг

Кальцитонин

РКП


Клонирование с использованием полимеразной цепной реакции (PCR).


AAAAAA полимеразной цепной реакции

CCCCCC

Какова будет структура праймеров

5’


PCR полимеразной цепной реакции в диагностике урогенетальных инфекций

Что плохо ?


Проблема №1 полимеразной цепной реакции . Ошибки.


Проблема № полимеразной цепной реакции 2.

Откуда узнать последовательность для конструирования праймеров?

Выравнивание последовательностей

GGGGAGGGTCGCGCGGG-ACGGCCTGGC

TCAT+CA+G+AATG+AA-++T+AT++A+

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

CT+++CA+G++GTG+AA-++TA++AA++

TT+++CC+G+ATTG+A+T++TCA+GA++

TT++TCC+G+AGT++A+T++TTTT+AA+

TT++TCC+G+AGT++A+T++TTTT+AA+

CT+AGTC+G+AGTA+AA-++TAATGA++

TCCCGGTGTAGCGGTGAAATGCGTAGAGATCGGGAG

+++A+++++++++++++++++++++++T+++T+++A

+T++++++G+++++++++++++A+T++++++++A+A

+T++++++G+++++++++++++A+T++++++++A+A

+T++++++G++++++++++++++++++++++++A+A

+T++++++G++++++++++++++++++++++++A+A

+++AT+++G+++++++++++++++++++++AT++++

C++TA+C+++A+A++++++++T+++++TT+TA++GA

C++TA+C+++A+A++++++++T+++++TT+TA++GA

+++G+++++++++++++++++++++++++++++++A

+++AC+++++++++++++++++++++++++GT++++


Ap полимеразной цепной реакции r

LacZ

Полилинкер

Ori

Клонирование амплификата


ad