Download
the iwgsc strategies activities to sequence the bread wheat genome n.
Skip this Video
Loading SlideShow in 5 Seconds..
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome PowerPoint Presentation
Download Presentation
The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome

The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome

291 Views Download Presentation
Download Presentation

The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. The IWGSC: Strategies & Activities to Sequence the Bread Wheat Genome Kellye A. EversoleIWGSC Executive Director & The IWGSC Wheat Breeding 2014: Tools, Targets, & Progress Harpenden, United Kingdom 29 January 2014

  2. The International Wheat Genome Sequencing Consortium Launched in 2005 on the initiative of Kansas Growers

  3. Wheat Improvement is Complex • Yieldpotential and yieldstability • Adaptation to climate change • Quality of grain and co-products • Durable resistance to biotic stress

  4. Complexity Requires an Integrated Toolbox Training, capacity building -> expertise and critical mass Improved wheat varieties

  5. Managing the 17 Gb, Hexaploid Genome B A ; Dissection of the genome into single chromosomes (arms) D AA BB Sheath fluid Triticumaestivum (2n = 6x = 42) 1C ~ 17,000 Mbp Flow chamber Laser Fluorescence emission Excitation light DD Deflection plates Scattered light Doležel et al., Chromosome Res. 15: 51, 2007 • Chromosomes: 605 - 995 Mbp(3.6 – 5.9% of the genome) Waste • Chromosome arms: 225 - 585 Mbp(1.3 – 3.4% of the genome) • Chromosome genomics • Chromosome specific BAC libraries and sequencing IEB

  6. Faster and cheaper methods to tackle the wheat genome Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI www.genome.gov/sequencingcosts. http://flxlexblog.wordpress.com/2012/12/03/developments-in-next-generation-sequencing-a-visualisation/

  7. A sequence for whom & for what purposes Feuillet et al, TIPS, 2010

  8. BAC by BAC vs WGS √ BAC by BAC (physical map) TEs Genes 500 kb Whole genome shotgun

  9. IWGSC Strategy for a Reference Wheat Genome Sequence 1. BAC library construction GAATTCTTGGTCAGCAATAAGGACAAAGAA GAATTCCTCCTGTGCGGCCGTTTTA GAATTCATGCTCCAGCCAACTCATCCAAAA GAATTCAACAATATAAATATCACCTAAAGC GAATTCCATCAGTATGGAGTTTCTTCATGC GAATTCAAGCTTGAGTATTCTATAGTGTCA GAATTCAATATGTAGAAATTATAGGATGGC GAATTCACCGGAAGGGGTTCCGGGTGTTTC GAATTCCGGAACGCTTCCGGAGACCAAACA GAATTCTGGAATCACTTGATGATGAATCAG GAATTCTGGAGTCTTCCTTTCCGCAGCGAA GAATTCAACGAAATAGTTATGAAATAGAAG GAATTCTGGGGTAACGATGGAATCCTACAC GAATTCTGTCAACGACACTATCATCAGGAA GAATTCTTCGATGCACTGAGTCGCACGGTT GAATTCTTGTGTGAGGTCCGCGTCCTAGAT 2. BAC fingerprinting (HICF/WGP) 3. Contig assembly by FPC/LTC 4. MTP sequencing /Scaffoldassembly 5. Pseudomolecule construction (meiotic/LD/RH mapping) 6. Automated and curated annotation

  10. Roadmap to the Wheat Genome Sequence Physicalmapping of individual chromosomes Survey sequencing of individual chromosomes Long term MTPsequencing Short term Gene catalog Virtual order Markers A referencesequenceanchored to the genetic and phenotypicmaps

  11. Current status of individual projects Physical maps Illumina Survey sequences Pseudo-molecules

  12. IWGSC Chromosome Survey Sequencing Initiative ~50X Illumina sequence Amplified DNA- sorted individual chromosomes Gene modeling, virtual ordering (GZ), annotation, functional, structural analyses Chromosome arm sequence assemblies Composition and Evolution of the 21 Bread Wheat Chromosomes >30X Illumina sequence A, S, D, & AB genomes (7) Read/assembly alignment to chromosome arms

  13. IWGSC Chromosome Survey Sequencing - Summary Summary • Almost full wheat gene complement identified and allocated to chromosome arms • On average, 53% of genes virtually ordered along chromosomes • High level of inter- and intrachromosomal duplication • Over 3.5 M markers mapped to contigs (1.3M wheat markers + 2.3M SNPs) - SSR, EST, DArT, SNP (90k) markers... • 13.2 million SNPs from POPSeq aligned to contigs

  14. IWGSC CSS Resources are Facilitating • New phylogenetic analyses of wheat genome evolution • Definition of core and pan gene sets for Triticeae by comparing di-tetra- and hexaploid genomes • Homoeologue-specific gene expression analyses • Wheat haplotype map – E. Akhunov • TILLING projects in T. durum and bread wheat – UC, Davis, JIC, Rres • Establishment of WheatNet – UC, Davis

  15. 3B SEQuencing Project Chr 3B physical map Sorted chr. 3B 1,282 BAC-contigs 8,441 BACs Pool of 10 BACs (Roche 454 GSFLX Titanium, 8 Kb MP) (~35X) 922 pools Illumina (82X) Sanger (2*108 bp) PE 0.5 kb (2*600 bp) 3B pseudomolecule assembly and analyses Catherine Feuillet & Fred Choulet

  16. An integrated and ordered 3B reference sequence MetaQTL analysis 3B consensus map (5000 markers) 3B Physical map 3B pseudomolecule

  17. Map-based cloning projects on 3B • 40 genes and QTL mapped on 3B • 4722 markers on 3B consensus map, 3102 in 964 SC (679 Mb =82 % of the sequence) • 13 map-based cloning projects • Disease resistance genes (Sr, Lr, Yr, Stb…) • Solid stem (saw fly) • Yield • Drought tolerance • Boron transporter • Flowering time • NUE • Chromosome pairing…

  18. 3B Physical Xgwm114 SSt1 3BL Xfba217 XBE200774 ctg580 ctg854 Xgwm4703 Xgwm114 ctg668 XBE200774 Xwmc274 XPSP3001 ctg165 SSt1 Xgwm247 Xgpw4513 Xgwm340 Xgwm340 Xtam63 Xgwm247 Xfba310 Xgwm181 Xfba133.2 Xfbb293 Xdarts149 Xgwm181 Xgwm547 Xbarc68.2 Xgpw4513 Curtis Pozniak A Breeder’s Perspective • 3 weeks • 12 cosegregating markers (SNPs) • no phenotyping in the fields • No ascertainmentbias • 1 year • 1 EST marker, not closer • ascertainmentbias

  19. Speed Gene Discovery: Towards Cloning SSt1 2.8 cM Approx. 2.2 Mb 13.3

  20. Power of A High Quality Reference Sequence Number of QTLs Cloned Rice Wheat Feuillet et al, Trends in Plant Sciences, 2010; Rey et al, unpublished update)

  21. Wheat Sequences Available Now WCS MTP WGS CS 3BSEQ (2013) CS chromosome surveysequences (2013) CS WGS 5x (2012) A and D genomerelatedancestors (2013) 94% real order Max 50% using synteny and geneticmapping (GZ): « virtualorder » completeness of information Gold standard

  22. IWGSC Projects

  23. Curtis Pozniak IWGSC Resources in Breeding • Unlimited source of DNA markers for MAS/Genomic Selection • Candidate genes for traits = perfect markers • Reduce the time and improve the success of resolving QTL • Discovery and exploitation of new alleles BAC Libraries Physical Maps Wheat Survey Sequence 3B Sequence

  24. IWGSC Resource Access • All resources accessible at URGI, Versailles • Raw sequence reads in the SRA • IWGSC CSS assemblies available at URGI and EBI • IWGSC CSS assemblies & gene models integrated into EnsemblPlants http://wheat-urgi.versailles.inra.fr/Seq-Repository/ http://plants.ensembl.org/Triticum_aestivum • 272 institutions • 40 countries • 52,000 BLAST searches • 2.500 downloads

  25. Thank you for your attention!www.wheatgenome.org@wheatgenome