230 likes | 267 Views
Plastids. Plastids (derived from proplastids) Chromoplast Chloroplast Amyloplast Leucoplast Elaioplast Etioplast. Plastid. nucleoid.
E N D
Plastids • Plastids (derived from proplastids) • Chromoplast • Chloroplast • Amyloplast • Leucoplast • Elaioplast • Etioplast Plastid nucleoid In plants, meristamatic cells contain 10-14 proplastids, each carrying 1-2 nucleoids per proplastid, whereas leaf cells may contain 100 chloroplasts, with 10-14 nucleoids each. There are several ptDNA per nucleoid. Thus proplastids contain lower copies of ptDNA than chloroplasts. ptDNA copies
The Structure of of O. sativa Chloroplast Genome ~120 genes ~50 transcription units Two inverted repeats One large single copy region One small single copy region These are salient features of any higher plant plastids
Conserved Features of Chloroplast Genomes in Higher Plants LSC IRB SSC IRA Tobacco (155,939 bp) 86,686 25,341 18,571 25,341 Maize (140,387 bp) 82,355 22,748 12,536 22,748 Rice (134,525 bp) 80,592 20,799 12,334 20,799 Marchantia (121,024 bp) 81,095 10,058 19,813 10,058 Black pine (119,707 bp) 65,696 495 53,021 495 Epifagus (70,028) 19,799 22,735 4759 22,735 LSC= Large single copy region SSC= small single copy region
Gene DesignationGene Product I. Genetic System Chloroplast RNA genes rDNA Ribosomal RNAs (16S, 23S, 4.5S, 5S) trn Transfer RNAs (30 species) Gene transcription rpoA, B, C RNA polymerase a, b, b’ subunits ssb ssDNA-binding protein Protein synthesis rps2,3,4,7,8,11 30S ribosomal proteins (CS) 2, 3, 4, 7, 8, 11 rps12, 14, 15, 16, 18, 19 CS12, 14, 16, 18, 19 rpl2, 14, 16, 20, 22 50S ribosomal proteins (CL) 2, 14, 16, 20, 22 infA Initiation factor I II. Photosynthesis Photosynthetic proteins rbcL RUBISCO large subunit atpA, B, E ATP synthetase CF1a, b, e subunits atpF, H, I ATP synthetase CF0I, III, IV subunits psaA, B, C Photosystem I A1, A2, 9-kDa protein psbA, B, C, D, E Photosystem II D1, 51 kDa, 44 kDa, D2, Cytb559-9kDa psbF, G, H, I Photosystem II Cytb559-4kDa, G, 10Pi, I proteins petA, B, D Electron transport Cytf, Cytb6, IV subunits Respiratory proteins ndhA, B, C, D NADH dehydrogenase (ND) subunits 1, 2, 3, 4 ndhE, F NDL4L, 5 III. Others Maturase matK Protease clpP Envelope membrane protein cemA Genes Encoded in the Chloroplast Genomes in Higher Plants
Organization of chloroplast genes into operons Polycistronic mRNA psbB psbT psbH petB petD Intron Intron psbN Monocistronic mRNA
The Endosymbiont Theory Common ancestor of plastid and modern cyanobacteria Flowering plant Photosynthetic eukaryotic cell Protoeukaryotic cell Photosynthetic C-reduction Respiration Common ancestor of mitochondira and a-group of modern proteobacteria
The Endosymbiont Theory Supporting Evidences 1. Molecular architecture and genome replication a) Plastid genomes are naked covalently closed circular DNA molecules (devoid of histones). b) Replication of plastid DNA is independent of the nuclear genome replication c) Promoters of most chloroplast genes contain DNA sequences similar to the E. coli ‘- 10’ and ‘-35’ promoter motifs. d) Chloroplast open reading frames are polycistronic. e) Plastid genomes contain few moderately or highly repetitive sequences f) Chloroplast genomes of Euglena, Chlamydomonas and most angiosperms carry 2 or 3 rRNA genes which are similar in size to their prokaryotic homologs (23S, 16S, 5S)
Chloroplast promoters “-35” “-10” psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA Mustard Spinach
Features of chloroplast transcription 1) Chloroplast promoters- similar to bacterial minimal promoter. “-35” “-10” Mustard psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA Spinach 2) Polycistronic. 3) Cis-elements located in the 5’-UTR. 4) Nuclear-encoded transcription factors.
Features of chloroplast translation (similar to prokaryotic translation) 1) Makes use of 70S ribosomes. 2) Uses fMet-initiator tRNA for the translation initiation codon. 3) The mRNAs are not capped. 4) The mRNAs are not poly-adenylated. 5) Ribosome binding occur in Shine-Delgarno-like sequence motif in the 5’-UT of mRNA. 6) Not coupled to transcription and trnaslational units can occur as stable ribonucleoprotein complexes.
The Endosymbiont Theory (cont.) Supporting Evidences 2) Transcription a) RNA polymerases from cyanobacteria (e.g. Chlamydomonas) and higher plants (e.g. maize) are more similar to the eubacterial than to the nuclear homologs. b) Genes encoding for proteins of related functions are organized into operons and thus are co-transcribed. c) The limiting regulatory step of gene expression is at post-transcriptional and translational level. d) Transcription terminators are more similar to bacterial sequences. d) A minor fraction of chloroplast mRNAs are polyadenylated.
The Endosymbiont Theory (cont.) Supporting Evidences 3) Translation a) Plastid ribosomes are more similar to prokaryotic ribosomes than to their cytoplasmic counterparts: cytoplasmic ribosomes- 80S (40S + 60S subunits) Plastid and prokaryotic ribosomes- 70S (30S + 50S subunits) Antibodies raised against 70S and 30S subunits of plastid ribosomes are active against E. coli b) Plastid ribosomal RNA gene sequences are more similar to modern cyanobacteria (e.g. Synechococcus lividus) than to their nuclear counterparts.
The Endosymbiont Theory (cont.) Supporting Evidences 4) Others (biflagellate protists) The case of Cyanophora paradoxa (and other types of marine nudibrachs or sea slugs) Endosymbiotic Cyanobacterium Photosynthetic Cyanelle Cyanophora paradoxa
Plastid transformation • Basic Requirements: • Method of delivery (Biolistic method) • Selectable marker (dominant marker) First successful plastid transformation was reported in 1988 for chlamydomonas. Then in 1990 for tobacco. Since then only tomato has been added to the list of reproducible systems, though reports exist for cotton, wheat etc. Micro-projectile DNA-coated gold particles Plate to stop nylon projectile Vents Firing pin Target cells or tissues Nylon macro-projectile Helium gas Spectinomycin inhibits protein biosynthesis (70S ribosomes) AMP Spectinomycin Adenylylspectinomycin (inactive protein synthesis inhibitor) 3”-adenylyltransferase (aadA) Construct: “-35” “-10” 5’-UTR SD aadA-ORF 3’-UTR
A transformed plastid genome is formed by two recombination events that are targeted by homologous sequences. The plastid genome segments that are included in the vector are marked as the left (LTR) and right targeting regions (RTR).
Chloroplast Genetic Engineering Prokaryotic – No need for codon optimization 10, 000 copies per cell – high expression Maternal inheritance Not expressed in fruits ? Multigene engineering Homologous recombination
Maternal Inheritance Multigene Engineering Gene Containment Hyper- expression Advantages of Chloroplast Transformation No Vector Sequences No Pleiotropic Effects No Gene Silencing No Position Effect
A. Cry2Aa2 Single Gene Expression 0.4 0.35 0.3 0.25 % Total Soluble Protein 0.2 0.15 0.1 0.05 0 Control young mature old Transgenic Leaf Age B. Cry2Aa2 Operon Expression 50 40 30 % Total Soluble Protein 20 10 0 Control young mature old Transgenic Leaf Age 100 fold higher expression obtained by plastid transformation (B) compared to nuclear transformation (A)
Heteroplasmy vs homoplasmy Accelerated gold particle coated with transforming DNA Several cycles of antibiotic selection (homoplasmy) ~10,000 plastid genomes/cell nucleus biogenesis sorting Primary plastid transformation event (change of single plastid DNA molecule) Cell and organelle divisions under antibiotic selection (heteroplasmy) chloroplast proplastid
Selection of transplastomic clones by spectinomycin resistance. (A) Spectinomycin inhibits callus formation, greening, and shoot regeneration from tobacco leaf segments on shoot regeneration medium. Transplastomic clones are resistant to spectinomycin and are identified as green shoots or calli. (B) The shoots are chimeric, visualized by accumulation of green fluorescent protein in transplastomic sectors. Spectinomycin resistance is not cell autonomous as sensitive sectors are also green. (C) Spontaneous spectinomycin resistant mutants are sensitive (top), transplastomic clones are resistant to streptomycin (bottom) when cultured on a selective streptomycin (500 mg/L) medium.
Comparison of the nuclear and plastid genomes of angiosperms Nuclear genome Plastid genome Chromosomes Two copies of each of ~60 copies of a single circular many chromosomes; chromosome per plastid the number of ~50–60 chloroplasts per cell chromosomes per diploid cell is species -specific Genes per chromosome Could be thousands ~120–150 Arrangement and Each gene is separate Many genes are in operons transcription of genes (individually transcribed ) (transcribed together)
Selection markers Currently known primary markers are resistance to spectinomycin, streptomycin, and kanamycin, which inhibit protein synthesis on prokaryotic-type plastid ribosomes. These antibiotics inhibit greening, cell division, and shoot formation in tobacco culture. Therefore, greening, faster proliferation, and shoot formation were used to identify transplastomic clones on a selective medium. The first transplastomic clones were obtained by spectinomycin selection. Because spectinomycin allows slow proliferation of nontransformed tobacco cells it was assumed that the choice of a drug that enables such "nonlethal" selection is important to recover transplastomic clones. However, transplastomic clones were soon identified by kanamycin selection using an antibiotic concentration that is considered "lethal" (50 mg/L). Thus, slow proliferation of nontransformed cells on a selective medium is not an essential feature of the selection scheme. Initial transformation vectors carried a plastid 16S rRNA (rrn16) gene with point mutations that prevent binding of spectinomycin or streptomycin to the 16S rRNA. The rrn16 target site mutations are recessive, and were 100-fold less efficient than the currently used dominant aadA gene. Streptomycin resistance encoded in the rps12 ribosomal protein gene was also included in an early vector. The neo (aph(3')IIa) gene encodes neomycin phosphotransferase II [NPTII; APH(3')-II], and was used to select transplastomic clones in tobacco. The aphA-6 gene encodes aminoglycoside phosphotransferase or APH(3')-VI, and was used to select transplastomic clones by kanamycin and amikamycin resistance in Chlamydomonas and by kanamycin resistance in tobacco. Direct selection for spectinomycin resistance and for highly expressed kanamycin resistance genes, on average, yield one transplastomic line in a bombarded leaf sample.
Most of the lecture material is derived from: • Pal Maliga (2004) PLASTID TRANSFORMATION IN HIGHER PLANTS. Annual Review of Plant Biology. 55: 289-313. • Pal Maliga (2002) Engineering the plastid genome of higher plants. Current Opinion in Plant Biology 2002, 5:164–172