Figure
Download
1 / 1

1477 5956 11 3 S4 - PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on

Figure S3 Comparison between Deide_1p01260 & Deide_3p00210 genes, and RecAc & RecAp polypeptides.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '1477 5956 11 3 S4' - tegan


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
4258950

Figure S3 Comparison between Deide_1p01260 & Deide_3p00210 genes, and RecAc & RecAp polypeptides.

ATGGATACCGACCAGCACAAAGCXCTGCAAACCGCCATGAGCCAGATTGAAAAACAATTCGGCAAAGGCAGCATCATGAAACTCGGCGCCGAXAGCAAXCTCGACGTCCAGGCCATCAGCACCGGCAGCCTCAGCCTCGACGTCGCCCTXGGCGTCGGCGGCATCCCCAAAGGCCGCGTCACXGAAATCTACGGCCCCGAATCCGGCGGCAAAACCACCCTCGCCCTGAGCATCATCGCCCAGTCCCAGAAAGCCGGCGGCACCTGCGCCTTTATCGACGCCGAACACGCCCTCGACCCCGTCTACGCCCGCGCCCTGGGTGTGAACACCGATGACCTCCTGGTCTCCCAGCCCGACAACGGCGAGCAGGCCCTGGAAATCATGGAACTGCTGATCCGCTCCGGCGCCATCGACGTXGTXGTXGTGGACTCGGTGGCTGCGCTGACCCCCCGCGCXGAXATXGAXGGCGAGATGGGCGACAGCCTCCCGGGGTTGCAGGCCCGGCTGATGAGCCAGGCGCTGCGCAAACTCACCAGCATCGTCTCCAAAACCGGCACCGCCGCGATCTTCATCAACCAGGTGCGCGAGAAGATCGGCGTGATGTACGGCAACCCCGAAACCACCACCGGCGGXAAGGCCCTGAAGTTCTACGCCTCGGTCCGGTTGGACGTXCGCAAGATGGGCGGCAAGTCCACCATGGTCGACAATGTGGCXGTGTCGCACAGCGTCAAGGTCAAGACCGTCAAGAACAAGGTCGCGCCGCCGTTCAAGGAAGTGGAGCTGACGCTGCGCTAXGGXCACGGXTTCGATGCXATGGATGACCTGGTCACGCTCGCCACCACTTTCGAGGTGATCAAGAAGGCTGGGAGCTTCTACAGCTACGGGGACGAACGCATCGGGCAGGGCAAGGAAAAAGCCATTGCCTTCCTGAGTGAGCGTCCGGATCTGCTTGCCGATATCCGCGAGCGTGTGCTXGCCCAGATGCGCGGCACCCCTGTCGCXCCXCTCCCTGAACCCGCCCTCTCTGCCGACTGA

A

MSKDSTKELSAPTDARERTKAIETAMSQIEKAFGKGSIMKLGAESKLDVQSVSTGSLSLDLALGIGGIPRGRVTEIYGPESGGKTTLALSIVAQAQKAGG

..|| :.||::||||||||.|||||||||||:||||||::||||||||:|||:||||:|||||||||||||||||||||:||:|||||

MDTD---QHKALQTAMSQIEKQFGKGSIMKLGADSKLDVQAISTGSLSLDVALGVGGIPKGRVTEIYGPESGGKTTLALSIIAQSQKAGG

TCAFIDAEHALDPVYARALGVNTDELLVSQPDNGEQALEIMELLVRSGAIDVVVVDSVAALTPRAEIEGEMGDSLPGLQARLMSQALRKLTAILSKTGTA

||||||||||||||||||||||||:|||||||||||||||||||:||||||||||||||||||||||||||||||||||||||||||||||:|:||||||

TCAFIDAEHALDPVYARALGVNTDDLLVSQPDNGEQALEIMELLIRSGAIDVVVVDSVAALTPRAEIEGEMGDSLPGLQARLMSQALRKLTSIVSKTGTA

AIFINQVREKIGVMYGNPETTTGGRALKFYASVRLDVRKI-GQPVKLGNDAVGNTVKVKSVKNKVAPPFKEVELTLMYGKGFDQLSDLVTLASDMDIIKK

||||||||||||||||||||||||:||||||||||||||: |:...:.|.||.::||||:||||||||||||||||.||.|||.:.||||||:..::|||

AIFINQVREKIGVMYGNPETTTGGKALKFYASVRLDVRKMGGKSTMVDNVAVSHSVKVKTVKNKVAPPFKEVELTLRYGHGFDAMDDLVTLATTFEVIKK

AGSFYSYGDERIGQGKEKAIAYIAERPEMEQEIRDRVLNAIRGGASEQPTKPALAE

|||||||||||||||||||||:::|||::..:||:|||..:||.......:|||:.

AGSFYSYGDERIGQGKEKAIAFLSERPDLLADIRERVLAQMRGTPVAPLPEPALSAD

B


ad