taurus
Uploaded by
36 SLIDES
495 VIEWS
370LIKES

Understanding DNA and RNA: Structure, Replication, and Protein Synthesis

DESCRIPTION

This comprehensive overview explores the essential structures and functions of DNA and RNA, highlighting their critical roles in genetic information storage and protein synthesis. Learn about the double-helix structure of DNA, including the significance of nucleotides, hydrogen bonds, and the sugar-phosphate backbone. Discover the process of DNA replication and the differences between DNA and RNA, including transcription and translation. Gain insights into mutations and their effects on genetic sequences, as well as the mechanisms of protein synthesis within cells.

1 / 36

Download Presentation

Understanding DNA and RNA: Structure, Replication, and Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. DNA and RNA What does DNA look like? What are the elements that makeup DNA?

  2. DNA Structure= String of nucleotides (sugar, phosphate, base) *Adenine *Thymine *Guanine *Cytosine • purines - adenine, guanine • pyrimidines - cytosine, thymine

  3.  DNA Nucleotides Purines Pyrimidines Adenine Guanine Cytosine Thymine Phosphate group Deoxyribose

  4. Francis Crick and James Watson (1953) Twisted Double Helix Hydrogen Bonds are the “glue” that keeps the two strands together Each strand of the helix is a chain of nucleotides What holds the strands together?

  5. **REMEMBER THIS PHRASE** Always Together….Great Couple Y T O S I N E U A N I N E D E N I N E H Y M I N E A & T G & C

  6.  Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G)

  7. How is DNA organized in a chromosome? Did You Know? Remember Chromatin?? ONE nucleus of ONE human cell = more than 1 meter of DNA!!! What exactly is chromatin? DNA tightly coiled around proteins forming Chromatin which pack together to form thick fibers.

  8. Prokaryotic Chromosome Structure Section 12-2 Chromosome E.coli bacterium Bases on the chromosome

  9. Figure 12-10 Chromosome Structure of Eukaryotes Nucleosome Chromosome DNA double helix Coils Supercoils Histones

  10. How can DNA use its double-stranded structure to its advantage for replication???

  11. **REMEMBER THIS PHRASE** “Something Old…Something New”

  12. DNA ReplicationWhen does this occur in the cell cycle? Template 1) Enzymes un-twist and unzip the molecule (break H bonds between base pairs). 2) Each strand serves as a template (something “OLD”) 3) Free nitrogen bases form bonds and make complementary strands (Something “NEW”) 4) DNA Polymerase bonds the nucleotides and proofreads the molecule

  13.  DNA Replication Original strand DNA polymerase New strand Growth DNA polymerase Growth Replication fork Replication fork Nitrogenous bases New strand Original strand

  14. DNA vs. RNA • RNA – also a long chain of nucleotides (5-carbon sugar, phosphate group, nitrogenous base) • Differences: • RNA sugar = ribose, instead of deoxyribose • RNA – usually single-stranded • RNA has uracil to replace thymine (so U binds with A) “Always United & Great Couple”

  15. RNA is in charge of assembling Amino Acids into Proteins

  16. From DNA(Gene) to Protein The players: DNA - sequences of nitrogen bases forms the genetic code mRNA - messenger RNA - makes a copy of the DNA in the nucleus and brings it to the rRNA • tRNA - transfer RNA - reads the mRNA and brings specific amino acids to the rRNA rRNA- ribosomal RNA - location of protein synthesis uses tRNA to make proteins

  17. Step 1: Transcription = recording the message • Occurs in nucleus • New mRNA strand forms from one of DNA strands (creating the message) • Let’s Practice…

  18. Transcription Practice • Transcribe the DNA molecule below: ATTATCGCGTAATGCTAATAGC TAATAGCGCATTACGATTATCG Template mRNA transcript AUUAUCGCGUAAUGCUAAUAGC

  19. Figure 12–14 Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNApolymerase DNA RNA

  20. Step 2: Editing of mRNA Introns are removed – non coding regions of the DNA molecule Exons remain – sequences that will be expressed

  21. Step 3: Translation = Protein Synthesis • Occurs at ribosome • tRNA reads mRNA which has message from genetic code (DNA) • Genetic code is read 3 letters at a time, so each word is 3 bases long

  22. Every 3 letters is a CODON • Each codon codes for a specific amino acid. What does an Amino Acid do again? Helps make proteins! • We need codons for Protein Synthesis (Translation) • They are like directions to make proteins • Every set of directions tells you where to START and where to STOP • We too have these, we call them the “start and stop codons”

  23. START is always: AUG STOP is always: UAA UAG UGA Codons to remember…

  24. Translation Explained • tRNA UAC • mRNA AUGCGCAUAACGCAU methionine Start Codon

  25. Alternate sequence: There are 20 different amino acids to be coded for. There are 64 possible codons. Stop codon Start codon

  26. Figure 12–17 The Genetic Code

  27. Translation Practice • Make a polypeptide (chain of amino acids) chain from the mRNA molecule AUGAUCGCGUAUUGCUACUAG - mRNA methionine-isoleucine-alanine-tyrosine-cysteine-tyrosine STOP

  28. Figure 12–18 Translation Section 12-3

  29. Figure 12–18 Translation (continued) Section 12-3

  30. Mutations - changes in the DNA sequence • Gene mutation- changes in a single gene • Point Mutations - substitution of one nucleotide for another • Frame Shift Mutations - shifting of the genetic code due to insertion or deletion of nucleotide • Chromosomal mutation changes in the entire chromosome (containing many genes)

  31. Figure 12–20 Chromosomal Mutations Deletion Duplication Inversion Translocation

  32. Mutation Analogy THE FAT CAT ATE THE RAT substitution THE FAT CAT ATE THE CAT *The letter “C” was substituted for the “R” insertion THE FAT CAT ATE THE RAT THC EFA TCA TAT ETH ERA T *Because the “C” was added, all other letters shifted down, thereby changing the amino acids that are made. C Deletion THE F A T CAT ATE THE RAT THE FTC ATA TET HER AT *Again, the amino acids will change b/c the “F” was removed

  33. Mutation Practice AUGA CGCGUAUUGCUACUAG - mRNA U • What will the new amino acid be if the 5th nucleotide is substituted with an adenine? ASPARAGINE What will the new amino acid sequence be if a guanine is inserted between the 9th and 10th nucleotide ? G GUA = VALINE

  34. When a mutation occurs… • If the amino acid sequence is stopped early (a STOP codon is reached) = Nonsense • If the amino acid sequence continues but the wrong amino acids are coded for = Missense

  35. Putting it all together • What is the amino acid sequence that forms from the following DNA molecule? (DNA synthesis) TACTACACCGTATAACAGGGCCTAGCAACT Template ATGATGTGGCATATTGTCCCGGATCGTTGA

  36. (Transcription) DNA - TACTACACCGTATAACAGGGCCTAGCAACT mRNA - AUGAUGUGGCAUAUUGUCCCGGAUCGUUGA (Translation) amino acid sequence methionine-methionine-tryptophan-histidine-isoleucine-valine-proline-aspartic acid-arginine-stop

More Related