190 likes | 425 Views
Marine Bacteria Cultivation Michael Clement Dr. Stephen Giovannoni. Purpose. To culture and grow ecologically important marine bacteria from a complex marine environment Cultivation of marine microbes is difficult but necessary for phenotypic and genotypic analysis. Background.
E N D
Marine Bacteria CultivationMichael ClementDr. Stephen Giovannoni
Purpose • To culture and grow ecologically important marine bacteria from a complex marine environment • Cultivation of marine microbes is difficult but necessary for phenotypic and genotypic analysis
Background • We know lots of different marine organisms exist because we can detect their DNA • Most organisms we can detect we cannot grow in the lab
Background • SAR11 is abundant in marine waters worldwide • SAR11 plays a large, but not well understood role in the carbon cycle • SAR11 has been cultivated in the laboratory
Growth Medium • Oregon coast seawater filtered with a 0.1 micron filter • Autoclaving vs. Not autoclaving
Inoculation • 24-well Teflon plates • 5ml medium/well • Inoculate at 2.5 cells/well • Inoculated 144 wells • 24 negative control wells • Grew for three months
Growth Assessment • Guava flow cytometer • DNA binding dye • Assess cell density of culture
Growth Assessment Positive wells determined by visual comparison of Guava reads to uninoculated wells
Analysis • PCR • Gel electrophoresis • RFLP • Determine unique patterns
Growth results • 34% culturability • Some co-cultures and some pure culltures • Negative control wells had no growth
>7C6R_8294-27F_H03_009.ab1 Uncultured Thiotrichales ACTTAACGCGTTAGCTTCGCCACTAAAGGGTAAATCCCCCCAACGGCTAGTTATCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTACCCACGCTTTCGTACCTCAGCGTCAGTATTGGTCCAGAAAGCTGCCTTCGCCATTGATGTTCCTTCTGATATCTACGCATTTCACCGCTACACCAGAAATTCCACTTTCCTCTACCATACTCTAGTTGACCAGTTTCAAATGCAGTTCCCAGGTTAAGCCCGGGGCTTTCACATCTGACTTAATAAACCGCCTACGCACGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTAAAGTTAACGTCAAGGCTAACGGTTATTAACCGCTAACTTTTCTTCACAATTGAAAGTGCTTTACAACCCTCAGGCCTTCTTCACACACGCGGTATTGCTGGATCAGGGTTGCCCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTTCGGGCCGTGTCTCAGTCCCGATGTGGCTGATCATCCTCTCAGACCAGCTAAAGATCGTCGCCTTGGTAGGCTTTTACCCTACCAACAAGCTAATCTTACGCAGGCTCATCTGATAGCGTGAGGCTCGAAAGTCCCCCACTTTACTACGAATAGATTATGCGGTATTAATCCGAATTTCTTCGGGCTATCCCCCACTATCAGGCAGATTCCTACGCGTTACTCACCCGTCCGCCACTCGACGCCTACTAGCAAGCTAGTATCGTTTCCGTTCGACTTGCATGTGTTAAGCATACCGCCAGCGTTCAATCTGAGCCAT
2 Uncultured Alphaproteobacteria 13 10 1 1 Thiotrichales 2 plastid/ cyanobacteria 1 Uncultured Gammaproteobacteria
Future Application • Two mixed cultures are undergoing continuing work • Uncultured Gammaproteobacteria (SAR 86?) • Plastid or cyanobacteria • Frozen stocks of cultures
Conclusion • Ongoing focus of the Giovannoni lab is to cultivate new species as well as diverse members of already cultivated species • Filtering medium verses autoclaving it is a potentially viable means of cultivating rare or uncultured organisms
Special thanks to… • Dr. Stephen Giovannoni For taking me into his lab • Dr. Kevin Ahern For his wonderful organization of this program • Paul Carini For all of his help day in and day out • The Howard Hughes Medical Institute For their continued support of this program