tala
Uploaded by
44 SLIDES
648 VIEWS
440LIKES

UNIT 5

DESCRIPTION

UNIT 5. Chapter 17: From Gene to Protein Chapter 18: Microbial Models Chapter 19: The Organization & Control of Eukaryotic Genomes Chapter 20: DNA Technology. Introduction. The Central Dogma is the molecular “chain of command” in a cell DNA  RNA  proteins

1 / 44

Download Presentation

UNIT 5

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. UNIT 5 Chapter 17: From Gene to Protein Chapter 18: Microbial Models Chapter 19: The Organization & Control of Eukaryotic Genomes Chapter 20: DNA Technology

  2. Introduction • The Central Dogma is the molecular “chain of command” in a cell • DNA  RNA  proteins • Transcription: DNA used to make mRNA • Translation: mRNA used to make protein/polypeptide

  3. Transcription: RNA Synthesis • RNA polymerase uses a template strand of DNA to base pair with • Transcription includes: initiation, elongation, termination • Initiation: RNA polymerase identifies template strand by presence of promoter • TATA box • Transcription factors

  4. RNA polymerase base pairs RNA nucleotides with the template strand • Uracil is used in RNA rather than thymine

  5. Elongation: double helix unwinds as RNA polymerase adds nucleotides • New RNA “peels off” of the DNA as it reforms the helix • A single gene can be transcribed by many RNA polymerase molecules at once

  6. Termination: elongation proceeds until a terminator is encountered • Primary transcript is released • In eukaryotes, the transcript is to be modified

  7. RNA Processing • Before translation, the primary transcript undergoes processing • 5’ cap: added to the 5’ end to prevent digestion by enzymes, also includes attachment site for ribosomes • Poly-A tail: added to the 3’ end to prevent digestion by enzymes, also helps with exportation from nucleus

  8. RNA splicing: non-coding sequences, introns, are removed, leaving only exons • Spliceosomes made up of snRNPs facilitate splicing of the exons

  9. Translation: Polypeptide Synthesis • The newly created mRNA (messenger RNA) enters the cytoplasm and is attached to a ribosome • Codons indicate which tRNA is complimentary • tRNA (transfer RNA) carries amino acids to the ribosome • Anti-codons correspond to codons

  10. Most codons correlate with a specific amino acid • Genetic code is redundant but not ambiguous • Start and stop codons

  11. The genetic code is very old and connects to our scientific understanding of evolution • It is almost universal • Foreign genes can be expressed by organisms

  12. There are 61 codons, but only 45 types of tRNA (anti-codons) • Base pairing rules are “relaxed” in the third position of the codon/anti-codon • Called wobble: U can base pair with A or G • The ribosome is the site of translation • P site: holds tRNA with growing polypeptide • A site: arrival site for next tRNA • E site: site for discharging tRNAs

  13. Translation includes: initiation, elongation, termination • Initiation and elongation require energy: GTP • Initiation: brings together mRNA, first amino acid and two ribosomal subunits • First – small ribosomal subunit locates and attaches at start codon • Second – tRNA carrying appropriate anti-codon (and methionine) arrives and attaches to mRNA

  14. Third – large ribosomal subunit arrives and covers the tRNA at the P site (GTP required) • Initiation is now complete

  15. P A met met E UAC UAC 5’ CGCCAUGCCUAGCACAUGACCUA 3’

  16. Elongation: brings together remaining tRNAs in order • First – the next tRNA will arrive and base pair with the codon at the A site • Second – using GTP, a peptide bond is formed between the new amino acid and the growing polypeptide • Third – using GTP, the mRNA and tRNA are moved in the 5’  3’ direction exactly three nucleotides (translocation)

  17. P A met met pro pro met pro E UAC UAC GGA GGA 5’ CGCCAUGCCUAGCACAUGACCUA 3’

  18. P A met pro met pro E UAC GGA UAC GGA 5’ CGCCAUGCCUAGCACAUGACCUA 3’ 5’ CGCCAUGCCUAGCACAUGACCUA 3’

  19. P A ser ser met pro met met ser pro pro E GGA UCG GGA UCG UCG 5’ CGCCAUGCCUAGCACAUGACCUA 3’ 5’ CGCCAUGCCUAGCACAUGACCUA 3’

  20. Summary of elongation

  21. Termination: ribosome encounters a stop codon • A release factor will base pair with the stop codon and hydrolyze the polypeptide from the last tRNA • (Avg. protein translation: ~1 min)

  22. Ribosomes • There are bound (on the rough endoplasmic reticulum) and free (in the cytoplasm) ribosomes • Bound: used to make proteins that will be secreted from the cell • Free: used to make proteins that will stay in the cytoplasm • Same mRNA can be translated by multiple ribosomes – polyribosomes

  23. Prokaryotes • Two major differences between eukaryotes and prokaryotes • There is no RNA processing • What is transcribed IS the mRNA • Transcription and translation are coupled END

  24. Bacterial Genetic Material • Bacteria possess a single chromosome • Double-stranded, circular • 4-6 million base pairs on average • Some bacteria carry plasmids with “non-crucial” genes • Separate from chromosome, also circular

  25. Variation in Bacterial Genetics • Bacteria can acquire new genes by one of three methods: transformation, transduction, conjugation • Transformation: bacteria take up foreign DNA and incorporate it into their chromosome • Can also be plasmids • Transduction: phages act as vectors for bacterial DNA • Accidental and rare

  26. Requires an F factor (fertility) – gene that allows for construction of a sex pilus • Hollow tube for transfer of plasmids • Most common type of shared plasmids = antibiotic resistance • Conjugation: bacterial “sex” is the direct transfer of genetic material between two bacteria

  27. Regulation of Bacterial Genes • Bacteria have relatively simple control systems for their genes called operons • Method for bacteria to turn on genes when needed and off when not • Operons have three components: a promoter, an operator, the gene(s) it controls • Promoter: site to which RNA poylmerase binds • Operator: site to which repressor protein binds • Repressor protein is always present in the cell

  28. The lac operon is an example found in E. coli • Genes produce proteins/enzymes to digest lactose • No lactose: • Repressor can bind to operator • Prevents RNA polymerase from transcribing genes lacZ, lacY, lacA • Lactose: • Lactose binds to repressor, changing its conformation so it cannot bind to operator • RNA polymerase can transcribe genes lacZ, lacY, lacA and digest the lactose END

  29. Introduction • Eukaryotic DNA is much more complex than that of prokaryotes • Little is known about expression • Highly active area of research • Genome is typically larger • Cell specialization limits expression of genes • Human genome possesses ~20K to 30K genes • >97% of the genome is non-coding • DNA is associated with MANY proteins • Complex packaging can influence transcription • Loose packing = frequent transcription; tight packing = infrequent transcription

  30. Gene Expression Controls • Only a small portion of a multicellular organism’s DNA is actively transcribed in any given cell • Cellular differentiation makes long-term control necessary • 200 cell types, 1 genome • Many levels of control exist to regulate expression in eukaryotes

  31. Molecular Basis of Cancer • Oncogenes are cancer-causing genes • Arise from changes in a cell’s DNA (mutations) • Chemical agents (carcinogens) or physical mutagens can alter proto-oncogene function • Mutations in tumor-suppressor genes can also cause cancer • Control adhesion of cells, inhibit cell cycle, repair damaged DNA, initiate apoptosis

  32. Example of proto-oncogene includes p53 • Mutations to gene occur in 50% of all cancers • Nicknamed the “guardian angel of the genome” • Damage to a cell’s DNA stimulates p53 expression • Acts as a transcription factor for several other genes • Activates p21 gene which halts cell cycle • Turns on genes involved in DNA repair • If damage is irreparable, it turns on “suicide genes” which causes cell death – apoptosis

  33. Development of Cancer • Usually, many mutations must occur for cancer to develop • Cancer is caused by the accumulation of mutations & mutations occur throughout life  the longer we live, the more chance of cancer • Many malignant tumors have an active telomerase gene • Viruses (esp. retroviruses) account for 15% of cancers • They may donate oncogenes or disrupt tumor-suppressor genes or convert a proto-oncogene END

  34. Restriction Enzymes • In nature, bacteria use restriction enzymes to cut foreign DNA • Restriction enzymes cut DNA at specific sites • Enzymes identify a restriction site to cut at • Restriction sites usually occur at many places in a sequence of DNA

  35. Restriction sites may occur at many locations, so the enzyme will make many cuts • Often times, a staggered cut is made, producing sticky ends that can base pair with its compliment

  36. DNA Cloning Vectors • Bacterial plasmids are used as cloning vectors • DNA molecule that carries foreign DNA into a cell • Bacteria can pass on their plasmids to daughter cells • Less complex than eukaryotes, reproduce faster • Cloning a human gene in bacteria steps • Isolation of vector and gene of interest • The vector is a plasmid • Plasmid engineered to carry a gene for resistance to an antibiotic

  37. Insertion of gene of interest into vector • Restriction enzymes used on both plasmid and gene of interest to produce compatible sticky ends • Gene and plasmid fragments mixed and DNA ligase joins them together • Introduction of recombinant vector into cells • Bacteria are transformed by taking up plasmid • Both recombinant and non-recombinant bacteria are created

  38. Cloning of cells (and gene of interest) • Bacteria are spread onto agar plates containing an antibiotic • Antibiotic ensures that only bacteria with the plasmid will grow • Transformed bacteria display “extra” trait

  39. Complimentary DNA - cDNA • RNA processing doesn’t occur in prokaryotes, so it can be difficult to get them to express eukaryotic DNA • A fully processed mRNA is needed since its lacking introns • mRNA acts as a template for making DNA • Reverse transcriptase used to make DNA from RNA • Reverse transcriptase isolated from retroviruses • Product is a cDNA molecule, DNA with no introns compatible with bacterial DNA

  40. Creation of cDNA

  41. PCR • The Polymerase Chain Reaction (PCR) can be used to create billions of copies of a segment of DNA in a few hours • No cells are needed • Nucleotides, primers, DNA polymerase added into a test tube with our DNA to be copied

  42. PCR • Special DNA Polymerase is used

  43. Since 1985, PCR has had a huge impact on biotechnology and DNA from a variety of sources has been amplified • A 40,000 year old frozen wooly mammoth • TINY amounts of blood or semen (or other DNA evidence) from crime scenes • Embryonic cells for rapid diagnosis of genetic disorders • Viral genes from difficult-to-detect viruses like HIV END

More Related