The Amazingly Similar Genes of Dogs, Humans, and Mice

1. The Amazingly Similar Genes of Dogs, Humans, and Mice Andrew G. Clark and Stacey L. Hubbell Institute of Molecular Evolutionary Genetics Department of Biology Penn State University

2. Motivation for dog genomic analysis • Our acute awareness of dog phenotypes. • Model for cardiac physiology. • Depth of knowledge of nutrition. • Genetic partitioning by breeds. • Extensive documentation of behavioral, phenotypic, and morphological variation among breeds. • Human and dog chromosome maps line up well. • DNA sequence similarity to human.

3. Wide diversity of forms of the domestic dog

5. Milroy’s disease Endocardial fibroelastosis Congestive heart failure Hyperadrenocorticism Hyperinsulinism Achalasia Ulcerative colitis Pacreatitis Hepatorenal syndrome Von Gierke’s syndrome Cyclic neutropenia Multiple myeloma Hemophilia Factor VII deficiency Christmas disease Globoid leukodystrophy Familial amaurotic idiocy Neurogenic muscular cramps Hypoplasia of organ of Corti Retinal dysplasia Diabetic microaneurysms Prostatitis Hecht’s pneumonia Osteogenesis imperfecti Disk luxation Acetabular dysplasia Ehlers-Danlos disease Seborrheic dermatitis Impetigo Uremia Human Diseases with Dog Equivalents(selections from a list of more than 350)

6. Gray Wolf Canis lupus lycaon

8. Sequences of mitochondrial DNA show that dogs and wolves have often interbred. Vila et al. 1997. Science 276:1687-1689.

9. A wolf-dog hybrid owner says: "I have two wolf-dogs I take everywhere. I never fail to hear how they are the best-behaved animals ever seen. My dogs come when they are called. They also sit, stay and heel as well, with or without a leash. They both get along well with neighbors' ducks, geese, goats and horses. I throw large summer parties and my hybrids mingle among the guests and their children.”

10. The power of mouse genetics • Rich history as a model organism • Huge knowledge base of human- mouse gene matches. • Complex disorders: diabetes, hypertension, obesity • 6992 mapped protein genes • 7377 mapped microsatellites • Gene knockout technology

11. Hypertension Thyrotropin deficiency Obesity Megacolon Niemann-Pick disease tumors Macrocytic anemia Prenatal muscle degeneration Dystrophy of white matter Cochlear degeneration Pigmented retina Uterine cystic hyperplasia Lung tumors Senile osteoporosis Clubfoot Albinism Diabetes insipidus Renal amyloidosis Human Diseases with Mouse Equivalents

12. Homology: similar form due to common ancestry

13. Phylogenetic relationships Homo sapiens Canis lupus familiaris Mus musculus • Molecular Clock Estimates • Human-dog split ~83 MYA • Human-mouse split ~112 MYA (Kumar and Hedges 1998 Nature 392:917-920) (O’Brien et al. 1999 Science 286:458-481)

14. Our study plan • Retrieve all complete dog gene sequences (n = 254). • Find human and mouse homologous genes with BLAST. • Align the dog-human-mouse sequences. • Calculate sequence divergence and interpret the meaning quantitatively.

15. blast_tmp 241 ttgccaagccctgtcggagatgatccagttttacttggaggaggtgatgccccgggctga 300 dog U39569 237 ..........t....c.................t...................a...... 296 U38200 237 ..........t.......................c..................a...... 296 AF060520 237 ..........t....c.................t...................a...... 296 L26029 244 ..........t....t..................c..................aa..... 303 AB000514 237 ..........t....t..................c..................aa..... 296 L26031 244 ..........t....t..................c..................aa..... 303 L26030 244 ..........t....t..................c..................aa..... 303 M57627 267 ..........t....t..................c..................aa..... 326 human U11767 240 ..........t.......a...............c................a.a...... 299 AF043333 183 ..........t....t..................c..................aa..... 242 U11421 255 ..........t.......a...............c................a.a...... 314 Z29362 308 ..........t.......a...............c................a.a...... 367 U00799 237 ..........t.......a...............c....a...........a.a...... 296 AF088887 237 a.........t.......................c..a....c........g.aa..... 296 AF068058 283 a.........t.......................c..a....c........g.aa..... 342 AF012909 303 ..........t.......................c.a.t..............a...a.. 362 U93260 293 ..........t.......................c.a..............gaa...... 352 L37781 305 ..........t.a..a..a...............c...ta..a..........a...a.. 364 NM_010548 312 ..........t.a.....a...............c...ta..a..........a...a.. 371 mouse L02926 238 ..........t....a..a......a........c...ta..a..........a...a.. 297 NM_012854 281 ..........t....a..a......a........c...ta..a..........a...a.. 340 X60675 281 ..........t....a..a......a........c...ta..a..........a...a.. 340 AF097510 302 ............a.....a...............c...ta..a..........a...a.. 361 AF054604 129 ......t...t....c.................t...................a...... 188

16. Non-automatable aspects • Checking gene families • Gene redundancies • Sequencing errors • Files containing introns • Mitochondrial DNA

17. The Central Dogma DNA makes RNA makes protein.

18. Coding amino acids from RNA

19. The Genetic Code

20. Some definitions Silent site: a letter in the DNA code that can be changed without changing the protein encoded by the gene (also called “synonymous”) ps : proportion of silent sites that have changed

21. Mis-sense mutation: an altered letter in the DNA code that changes the amino acid sequence of the protein encoded by the gene (also called “nonsynonymous”). pn : proportion of mis-sense sites that have changed.

22. Most genes show much higher levels of silent divergence

23. Ratios of mis-sense to silent rates r = 0.933

24. Genes with excess mis-sense divergence • IDUA - a-L-iduronidase • CLN2 - pepstatin-insensitive lysosomal protease • NOS - nitric oxide synthase • CD34 - hematopoietic progenitor cell marker • PTH1 - parathyroid hormone receptor-1 • MMAC1 - mutated in multiple advanced cancers • GHR - growth hormone receptor

25. Inferred locations of substitutions on the tree dog 7902 14448 mouse 7062 human

26. Relative rates tests for silent and mis-sense sites Growth hormone receptor silent mis-sense dog 40 16 human 27 43 X2 = 13.49*** Translation: GH receptor gene is evolving way too fast in humans !

27. Unusually highly conserved genes tend to code for very basal functions GAq GTP-binding protein alpha 2 0.000000 rab2 GTP-binding protein (rab2) 0.000000 SPC22 microsomal signal peptidase 0.000000 SPC18 microsomal signal peptidase 0.000000 Sec61-B protein translocation complex 0.000000 tektin tektin (sperm development) 0.000000 centractin centractin (microtubule org.) 0.001379 rab7 GTP-binding protein (rab7) 0.002494 mitogen mitogen activated protein kinase 0.002920 ubiquitin ubiquitin-tagged degradation 0.004032 Kv3.1 Kv3.1 potassium channel 0.005252 fosB fosB transcription factor 0.006070

28. The X chromosome of humans and cats has the same gene order!!

29. Conclusions • Almost all human genes can be lined up unmistakably to genes in dogs, with an average mis-sense divergence of 7.5%. • By having three species with aligned genes, we can do branch-specific inferences. • The lineage to dog has faster silent rate relative to the lineage to humans • … but the human branch has an elevated mis-sense rate. • Several genes with elevated mis-sense rates suggest that evolution is driving these genes along at a faster rate than others.

31. Some dog websites • www.rufruf.com • www.purina.com • www.pfizer.com • www.petnet.com • www.petwellness.com/doghome.asp www.vgl.ucdavis.edu/research/canine/ www4.ncbi.nlm.nih.gov/PubMed/