240 likes | 263 Views
Explore the impact of SNP 637.A>C in NPHS2 gene exon 8 on steroid-sensitive and steroid-resistant nephrotic syndrome in children. Study conducted to determine the frequency and clinical implications of this polymorphism.
E N D
The 637 Adenine to Cytosine Single Nucleotide Polymorphism of NPHS2 Gene Exon 8 in Steroid-Sensitive and Steroid-Resistant Nephrotic Syndrome Prof. Dr. Ban A. AbdulMajeed
Introduction Nephroticsyndrome characterized by: • Edema • Massive proteinuria (>40 mg/m2/hr or a urine protein/creatinine ratio >2.0 mg/mg) • Hypoalbuminemia (<2.5 g/dl) • Hyperlipidemia
Genetics • Majority of NS occurs as a sporadic form, the incidence of familial cases is from 3 to 5%. • Genes: NPHS1, NPHS2, ACTN4, CD2AP ,WT1, TRPC6, and LAMB2. Proteinsencoded by these genes (nephrin, podocin, alpha-actinin-4, an adapter protein anchoring CD2 and others) influence the function of the podocytes.
Mutations in NPHS2 gene lead to autosomal recessive SRNS (histologically FSGS). It was concluded that patients with (SRNS) with homozygous or compound heterozygous mutations in NPHS2 have reduced risk for recurrence of (FSGS) in renal transplant (only 8% in comparison with 35% in patients without mutation in NPHS2). • Exon 8 of NPHS2 gene carries many polymorphisms. Some of them were reported in the literature to be associated with amino acid change, and others are not.
Aims of the study • To determine the frequency of SNP 637 A>C polymorphic site of exon 8 of NPHS2 in nephrotic syndrome patients. • To study the association of this polymorphic site to steroid resistance in nephrotic children. • To study the relation of the polymorphic site to the clinical status of nephrotic patients.
Patients, Materials and Methods Study design, location, and timing • This cross sectional study was conducted in Al-ImameinAl-kadhimein Medical City and Al-Nahraincollage of medicine spanning the period from the 1st of August 2016, to 30th of November 2016. • The study sample included 50 children with nephrotic syndrome, who were recruited at Al-ImameinAl-kadhimein Medical City, Child Central Teaching Hospital, Child Wellfare Teaching Hospital, and Al-KaramaTeaching Hospital.
The following data were collected from patients: • Sex • Age • Age of onset of nephrotic syndrome • Response to steroid therapy • Family history of nephrotic syndrome • Consanguinity • Hypertension • Hematuria • Lab. investigation: serum albumin, blood urea, and serum creatinine. • Renal biopsy if done and its report
Exclusion criteria: • Congenital nephrotic syndrome (onset before the age of one year). • Nephrotic syndrome due to well identified secondary causative factors • Children with nephrotic syndrome within the same age group but did not receive the standard regime of steroid therapy.
Sample collections: The parents of each child signed a written consent to participate in the research. Three ml of venous blood was collected from each patient in an EDTA-containing blood collection tube. Samples were transferred to the Molecular Pathology Laboratory in Department of Pathology and Forensic Medicine \ College of Medicine \ Al-Nahrain University for the purpose of molecular study.
Molecular methods • Genomic DNA extraction • TaqManReal Time PCR Genotyping Assay • Analysis included recording of positive and negative fluorescent detection of each of FAM labeled (mutated) and/or VIC labeled (wild type) probes.
Primers and probes • Sequence (5’→3’ direction) • Forward • GGTGAAGCCTTCAGGGAATG • Reverse • TTCTATGGCAGGCCCCTTTA • VIC-probe exon 8 • 5’VIC(GACATGTTTATAATGGAGATGCC) 3’BHQ • FAM-Porbe exon 8 • 5’FAM(CATGTTTCTAATGGAGATAGATGC) 3’BHQ
Results From total patients with nephrotic syndrome, 24 were SSNS and 26 were SRNS. Comparison of Sex and age between SSNS and SRNS group • This is similar to the study by Kumar et al from India,Madani et al from Iran and Rachmadi from Indonesia.
Allelic distribution of wild and mutated type alleles of NPHS2 exon -8 SNP 637 A>C between SSNS and SRNS groups
The NPHS2 exon 8 polymorphic site A637C was not previously reported to be associated with SRNS. Best to the present knowledge, this is the first study to deal with this SNP. • This A>C change in the nucleotide sequence results in an amino acid substitution of isoleucine to leucine in the polypeptide chain. It was shown to be present as a homozygote type in the majority of children with nephrotic syndrome included in the present study of both the SSNS and SRNS. However, it was only detected as a heterozygote character in 3 cases.
These findings suggest the importance of at least a single allelic damage of exon 8 gene as being pathological and associated with the development of nephrotic syndrome. • Mao et al, reported a single nucleotide polymorphism of 954T>C in the exon 8 in 5 patients and 4 controls. Another polymorphism of 1038A>G in the exon 8 was observed in 7 patients and 4 controls. There was no significant difference in the genotypic and allelic frequencies of these polymorphisms in the NPHS2 gene between patients and controls.
In the study of Guaragna et al, the authors reported the identification of NPHS2 mutations in only 14.8 % of both sporadic and familial SRNS cases in the Brazilian patients analyzed, after screening for mutations in the NPHS2, NPHS1 and WT1 genes. • Rachmadiet al, reported the identification of 6 NPHS2 polymorphisms in patients with clinical diagnosis of SRNS. Homozygous NPHS2 954C>T in exon 8, was found in 9 subjects. other NPHS2 polymorphisms were heterozygous.
Table (8): The comparison between homozygous versus heterozygous according to demographic, clinical and laboratory data
Similar to the present work, all the upper mentioned researches did not find a significant statistical association between the studied polymorphic sites on one hand and the clinical findings on the other hand.
Conclusions • SNP 637 A>C of NPHS2 exon 8 polymorphism was present in all cases of SSNS and SRNS. The majority were homozygous mutated, however no relation was present between this polymorphism and different clinical data. • In this study, the presence of C allele is indicative of occurrence of nephrotic syndrome as a whole regardless of steroid sensitivity pattern and the presence of C allele is suggestive of defective mutated protein.
Recommendations •Further studies including different Iraqi population are needed. • Analysis of the polymorphisms in healthy controls. • Because some NPHS2 mutations are associated with steroid-resistance, screening of patients with familial nephrotic syndrome and childhood sporadic FSGS for podocin mutations in order to spare drug toxicity or prevent delay of more effective therapy • Genetic testing for all podocyte genes is expensive, and the key challenge is to identify which patients are most likely to benefit from genetic study. • The present study recommends genotypic screening of patients with nephrotic syndrome in all exons of NPHS2 or doing whole gene sequencing to detect mutations or polymorphisms.