lecture 6 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Lecture 6 PowerPoint Presentation
Download Presentation
Lecture 6

Loading in 2 Seconds...

play fullscreen
1 / 25

Lecture 6 - PowerPoint PPT Presentation


  • 144 Views
  • Uploaded on

Lecture 6. Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week Discussion of Article 3. Experiment 3. Goal: To introduce basic procedures used to manipulate DNA.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Lecture 6' - sonja


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
lecture 6
Lecture 6
  • Experiment 3: Basic subcloning
  • Flowchart
  • Experiment 4: Light regulated genes
  • Principles and process of RNA isolation
  • Assignment 1 due next week
  • Discussion of Article 3
experiment 3
Experiment 3
  • Goal: To introduce basic procedures used to manipulate DNA.
  • General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation.
lab 6
Lab 6

A Vector

preparation

B Fragment isolation

DNA fragment isolation kit

lab 7
Lab 7

Ligation of vector and DNA fragment

T4 DNA ligase

how do we ligate a xhoi and sal i site together

How do we ligate a XhoI and Sal I site together?

GTCGAC SalI

CTGCTG

CTCGAG XhoI

GAGCTC

lab 8
Lab 8

A. Run ligation reactions on an agarose gel

B. Transform bacteria

lab 9
Lab 9

Blue white selection (screen)

lab 10 and 11
Lab 10 and 11
  • Small scale DNA isolation (Lab 2)
  • Restriction enzyme digestion (Lab 3)
experiment 4
Experiment 4
  • Goal: to characterize the response of light regulated genes.
  • Method: RT-PCR.
  • General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression.
slide12

1. wild-type grown in the light

  • 2. wild-type grown in the dark
  • 3. det1 grown in the light
  • 4. det1 grown in the dark

What are the expression levels of

light regulated genes (chlorophyll

a/b binding proteins CHAB and CLAB)

using tubulin as loading control.

CHAB

CLAB

det1-light

det1-dark

WT-dark

det1-dark

det1-light

WT-light

WT-dark

Ladder

WT-light

-Extract RNA

-RT mRNA

-PCR cDNA

CHAB or

CLAB

TUB

Picture of Plants (WT and mutant)

slide13

Isolation of RNA using Commercial Trizol Reagent

Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate

-lyses cells and dissolves cell components while maintaining integrity of RNA

Phenol

Chloroform

75%

EtOH

Isopropyl

alcohol

Liquid N2

Trizol

Aq

Org

Homogenize

Ppt RNA

DEPC

H2O

RNA

Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase)

Isopropanol: Precipitates RNA

75% Ethanol: Wash RNA pellet

DEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water

DEPC interacts with the active site histidine residue of RNAse and irreversibly

inactivates RNAses.

example sequence

Example sequence

GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA

AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA

GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG

TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC

CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA

CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT

AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC

CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG

AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC

AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG

TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC

CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA

ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG

slide17

Assignment 1

I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops.

You can make appointments for consultation as well. Time is running out.

Assignment 1 due next Monday Oct. 27, 2008