300 likes | 579 Views
Lecture 6. Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week Discussion of Article 3. Experiment 3. Goal: To introduce basic procedures used to manipulate DNA.
E N D
Lecture 6 • Experiment 3: Basic subcloning • Flowchart • Experiment 4: Light regulated genes • Principles and process of RNA isolation • Assignment 1 due next week • Discussion of Article 3
Experiment 3 • Goal: To introduce basic procedures used to manipulate DNA. • General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation.
Lab 6 A Vector preparation B Fragment isolation DNA fragment isolation kit
Lab 7 Ligation of vector and DNA fragment T4 DNA ligase
How do we ligate a XhoI and Sal I site together? GTCGAC SalI CTGCTG CTCGAG XhoI GAGCTC
Lab 8 A. Run ligation reactions on an agarose gel B. Transform bacteria
Lab 9 Blue white selection (screen)
Lab 10 and 11 • Small scale DNA isolation (Lab 2) • Restriction enzyme digestion (Lab 3)
Experiment 4 • Goal: to characterize the response of light regulated genes. • Method: RT-PCR. • General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression.
1. wild-type grown in the light • 2. wild-type grown in the dark • 3. det1 grown in the light • 4. det1 grown in the dark What are the expression levels of light regulated genes (chlorophyll a/b binding proteins CHAB and CLAB) using tubulin as loading control. CHAB CLAB det1-light det1-dark WT-dark det1-dark det1-light WT-light WT-dark Ladder WT-light -Extract RNA -RT mRNA -PCR cDNA CHAB or CLAB TUB Picture of Plants (WT and mutant)
Isolation of RNA using Commercial Trizol Reagent Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate -lyses cells and dissolves cell components while maintaining integrity of RNA Phenol Chloroform 75% EtOH Isopropyl alcohol Liquid N2 Trizol Aq Org Homogenize Ppt RNA DEPC H2O RNA Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase) Isopropanol: Precipitates RNA 75% Ethanol: Wash RNA pellet DEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water DEPC interacts with the active site histidine residue of RNAse and irreversibly inactivates RNAses.
Example sequence GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG
Assignment 1 I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops. You can make appointments for consultation as well. Time is running out. Assignment 1 due next Monday Oct. 27, 2008