1 / 25

Lecture 6

Lecture 6. Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week Discussion of Article 3. Experiment 3. Goal: To introduce basic procedures used to manipulate DNA.

sonja
Download Presentation

Lecture 6

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Lecture 6 • Experiment 3: Basic subcloning • Flowchart • Experiment 4: Light regulated genes • Principles and process of RNA isolation • Assignment 1 due next week • Discussion of Article 3

  2. Experiment 3 • Goal: To introduce basic procedures used to manipulate DNA. • General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation.

  3. Lab 6 A Vector preparation B Fragment isolation DNA fragment isolation kit

  4. Lab 7 Ligation of vector and DNA fragment T4 DNA ligase

  5. How do we ligate a XhoI and Sal I site together? GTCGAC SalI CTGCTG CTCGAG XhoI GAGCTC

  6. Lab 8 A. Run ligation reactions on an agarose gel B. Transform bacteria

  7. Lab 9 Blue white selection (screen)

  8. Lab 10 and 11 • Small scale DNA isolation (Lab 2) • Restriction enzyme digestion (Lab 3)

  9. Experiment 4 • Goal: to characterize the response of light regulated genes. • Method: RT-PCR. • General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression.

  10. Etiolation and det1

  11. Experimental set up

  12. 1. wild-type grown in the light • 2. wild-type grown in the dark • 3. det1 grown in the light • 4. det1 grown in the dark What are the expression levels of light regulated genes (chlorophyll a/b binding proteins CHAB and CLAB) using tubulin as loading control. CHAB CLAB det1-light det1-dark WT-dark det1-dark det1-light WT-light WT-dark Ladder WT-light -Extract RNA -RT mRNA -PCR cDNA CHAB or CLAB TUB Picture of Plants (WT and mutant)

  13. Isolation of RNA using Commercial Trizol Reagent Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate -lyses cells and dissolves cell components while maintaining integrity of RNA Phenol Chloroform 75% EtOH Isopropyl alcohol Liquid N2 Trizol Aq Org Homogenize Ppt RNA DEPC H2O RNA Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase) Isopropanol: Precipitates RNA 75% Ethanol: Wash RNA pellet DEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water DEPC interacts with the active site histidine residue of RNAse and irreversibly inactivates RNAses.

  14. Assignment 1

  15. Example sequence GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG

  16. Step into liquid

  17. Assignment 1 I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops. You can make appointments for consultation as well. Time is running out. Assignment 1 due next Monday Oct. 27, 2008

  18. Discussion of Article 3

  19. Taken from Hall J. C. Science

  20. Taken from Hall Science

More Related