slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
White (2n = 40) PowerPoint Presentation
Download Presentation
White (2n = 40)

Loading in 2 Seconds...

play fullscreen
1 / 4

White (2n = 40) - PowerPoint PPT Presentation


  • 88 Views
  • Uploaded on

Linkage disequilibrium (LD) across the NPY1R locus : Common polymorphisms discovered by re-sequencing in 4 human populations. Black (2n = 40). Asian (2n = 40). Hispanic (2n = 40). White (2n = 40). Numbers in diamonds: LD as r 2 *100 LD blocks defined by four gamete rule

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'White (2n = 40)' - shilah


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Linkage disequilibrium (LD) across the NPY1R locus:

Common polymorphisms discovered by re-sequencing in 4 human populations

Black

(2n = 40)

Asian (2n = 40)

Hispanic

(2n = 40)

White

(2n = 40)

Numbers in diamonds: LD as r2*100

LD blocks defined by four gamete rule

r2 color scheme: r2=0, white; 0<r2<1, shades of grey; r2=1: black.

On-line Figure 1

slide2

On-line Figure 2: NPY1R 3’-UTR polymorphism A+1050G influences gene expression in cella in 3 different cell lines: PC12 chromaffin cells, human embryonic kidney (HEK) cells, and HeLa fibroblasts. Results are shown at 24 h post-transfection.

On-line Figure 2

slide3

On-line Figure 3A

Human variant TCACTTTACCTAGCAGGGAAAAG-TACACAAAAACTGCAGATACT

Human wild-type TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAGATACT

Chimp TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAAATACT

Macaca TCACTTCACCTAGCAGGGAAAAAATACACAAAAACTGAGAATACT

Conservation ****** *************** ************* *****

3’-UTR A+1050G

On-line Figure 3A Human NPY1R 3’-UTR Variant Inter-species Sequence Alignment. The alignment shown spans 45 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicate that the position is identical in all sequences shown. Sequence alignment by Clustal-W.

slide4

On-line Figure 3B:Human NPY1R promoter variant A-585T inter-species sequence alignment. The alignment shown spans 60 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicates that the position is identical in all sequences shown. Sequence alignment by Clustal-W.

Human variant GCTAAGCGCTGGGAACAAATCTGACTTATTGCATTTTCTCAGTGGGCCAAAGAAAGGAGG

Human wild-type GCTAAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG

Chimp GCTAAGCGCTGAGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG

Rhesus ACTTAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG

** ******* **************** *******************************

A-585T

On-line Figure 3B