protein synthesis n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Protein Synthesis PowerPoint Presentation
Download Presentation
Protein Synthesis

Loading in 2 Seconds...

play fullscreen
1 / 30

Protein Synthesis - PowerPoint PPT Presentation


  • 83 Views
  • Uploaded on

Protein Synthesis. AP Biology Ch. 17. “One Gene-One Polypeptide” Theory. George Beadle and Edward Tatum (late 40’s to early 50’s) used X-rays to induce mutations in Neurospora crassa (bread mold)

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Protein Synthesis' - shauna


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
protein synthesis

Protein Synthesis

AP Biology

Ch. 17

one gene one polypeptide theory
“One Gene-One Polypeptide” Theory
  • George Beadle and Edward Tatum (late 40’s to early 50’s)
    • used X-rays to induce mutations in Neurospora crassa (bread mold)
    • Auxotrophs—nutritional mutants unable to synthesize certain amino acid and vitamins. They traced the defect to the enzymes involved in their synthesis.
  • Conclusion: One gene encodes one enzyme.
  • Gene products encode both protein and RNA
central dogma of molecular biology

RNA

Proteins

Central Dogma of Molecular Biology
  • In eukaryotic cells, a message (mRNA) carries the genetic information (DNA) from the nucleus to the cytoplasm  Transcription
  • An adapter (tRNA) translates the nucleic acid (mRNA) into amino acid (protein)  Translation
  • Information flow is unidirectional

GCTGCTAACGTCAGCTAGCTCGTAGCGCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAG

structure of rna
Structure of RNA
  • Single strand of nucleotides [instead of 2 strands in DNA]
  • Nucleotides contain 5-carbon sugar ribose [instead of deoxyribose in DNA]
  • 4 different nitrogenous bases
    • Adenine (A)
    • Uracil (U) [instead of thymine in DNA]
    • Cytosine (C)
    • Guanine (G)
forms of rna
Forms of RNA
  • 3 Main Types of RNA
    • mRNA (messenger RNA) brings DNA message out of nucleus to the cytoplasm
      • Each 3 bases on mRNA is a “codon”
    • tRNA (transfer RNA) –The anticodon that matches with the codon from mRNA to determine which amino acid joins the protein chain
    • rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules
transcription synthesis and processing of rna
Transcription: Synthesis and Processing of RNA
  • RNA Polymerase is an enzyme that synthesizes RNA using one strand of the DNA as a template
    • Separates 2 strands of DNA and links RNA nucleotides as they base-pair along the DNA template in an overall is 5’ to 3’ direction
transcription initiation
Transcription: Initiation
  • RNA polymerase attaches to promotor sequence (TATA box) of DNA sequence
    • Prokaryotes—enzyme binds directly to sequence
    • Eukaryotes—enzyme binds after transcription factors bind to the site
transcription elongation
Transcription: Elongation
  • RNA polymerase
    • Synthesizes in 5’ 3’ direction, anti-parallel to DNA template
    • Unwinds about 20 base pairs as it reads and synthesizes complementary RNA
transcription termination
Transcription: Termination
  • RNA polymerase terminates transcription at special DNA sequences, terminator
    • Prokaryote—stops right at the end of termination signal
    • Eukaryote—continues past termination signal, to a poly(A) tail (AAUAAA) in the pre-mRNA
transcription
Transcription
  • The code on DNA tells how mRNA is put together.
  • Example: DNAACCGTAACG
    • mRNAUGGCAUUGC

Each set of 3 bases is called a triplet or codon

(in mRNA)

UGG CAU UGC

rna splicing
RNA Splicing
  • Pre-mRNA never leaves the nucleus
    • Introns—non-coding regions
    • Exons—coding regions
  • snRNPs join with other proteins to form spliceosome, which releases introns
translation
Translation
  • Genetic information in mRNA is read by codons
  • 64 different codons
  • Genetic code is redundant—more than one codon codes for many of the 20 amino acids
  • AUG—universal start codon
  • UAA, UAG, UGA—stop codons
translation initiation
Translation: Initiation
  • Small ribosomal subunit binds to start codon (AUG) on mRNA
  • Initiator tRNA (UAC) base-pairs with mRNA
  • Large ribosomal unit binds so initiator tRNA is in the P site
  • GTP provides energy for intiation process
translation termination
Translation: Termination

Review entire

process

substitution mutations
Substitution Mutations
  • Missense mutation: altered codon still codes for an amino acid, although maybe not the right one
  • Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely
    • Leads to nonfunctional proteins
insertions and deletions
Insertions and Deletions
  • Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made
slide25

Ribosome

Reading direction

5’

3’

U U C U G G A U G U G G U U C U G G

mRNA

A

C

C

C

U

A

U

A

C

Incoming tRNA charged with amino acid

Met

Met

Trp

slide26

Ribosome

Reading direction

5’

3’

U U C U G G A U G U G G U U C U G G

mRNA

C

C

A

G

A

A

C

A

U

Outgoing “empty” tRNA

Trp

Met

Phe

slide27

Ribosome

Reading direction

5’

3’

U U C U G G A U G U G G U U C U G G

mRNA

A

C

G

C

A

A

C

C

A

C

A

U

Met

Phe

Trp

Trp

slide28

Ribosome

Reading direction

5’

3’

U U C U G G A U G U G G U U C U G G

mRNA

C

C

A

A

C

C

C

A

A

A

G

U

Phe

Met

Trp

Trp

slide29

Ribosome

Reading direction

5’

3’

U U C U G G A U G U G G U U C U G G

mRNA

C

C

C

A

A

U

A

A

G

C

A

U

Outgoing “empty” tRNA

Incoming tRNA charged with amino acid

Trp

Met

Phe

Anticodon

C

A

C

G

A

A

Trp

Phe

Amino acid