Chemistry and Biology of DNA in the Age of Personalized Medicines

1. Chemistry and Biology of DNA in the Age of Personalized Medicines Dr. Ishtiaq Ahmad Khan Assistant Professor Dr. Panjwani Center for Molecular Medicine and Drug Research International Center for Chemical and Biological Sciences, University of Karachi.

2. DNA in every organism

3. DNA – The molecule of Life The building blocks of DNA are nucleotides. each nucleotide composed of: • a nitrogenous base (adenine, thymine, guanine, cytosine abbreviated as A, T, G, C) • a 5-carbon sugar called deoxyribose • a phosphate group (PO4)

5. Nucleotides ester linkage Nitrogenous base (adenine) Phosphate group 5-carbon Ribose sugar

6. DNA Structure Nucleotides are connected to each other by phosphodiester bonds to form a long chain

7. Double helical Structure of DNA • 2 sugar-phosphate backbones • nitrogenous bases toward the interior of the molecule • bases form hydrogen bonds with complementary bases on the opposite sugar-phosphate backbone • A pairs with T (2 H bonds) • C pairs with G (3 H Bonds)

9. Noble Prizes in DNA Chemistry Watson, Crick, and Wilkins(1962): Discovery of structure of DNA H. Gobind Khorana (1973) Chemical synthesis of oligonucleotide Berg, Gilbert, and Sanger(1980): The determination of base sequences in nucleic acids Mullis and Smith(1993): Contributions to the developments of methods within DNA-based chemistry. Invention of PCR

10. Sequencing the DNA In the 1970’s, Sanger’s group discovered a method of 'reading' the linear DNA sequence using special nucleotide bases calledchain terminators or di-deoxy nucleotides. This method is still in use today. Frederick Sanger Died on November 19, 2013

11. Dideoxy Nucleotide

22. Massively parallel sequencing, Shotgun Genome Sequencing: for sequencing the whole genome and whole exome Next Generation DNA Sequencing Complete genome copies

23. Next Generation DNA Sequencing Fragmented genome chunks NOT REALLY DONE BY DUCK HUNTERS ! Hydroshearing, sonication, enzymatic shearing

24. Major NGS Platforms 454 FLX Genome Sequencer (Roche) Pyrosequencing method Hiseq2000, Solexa Genome Analyzer (Illumina) Sequencing by seynthesis SOLiD ( Applied Biosystems) Sequencing by ligation chemistry Ion-torrent (Life technologies) An integrated semiconductor device enabling non-optical genome sequencing Heliscope (Heliscope Biosciences) Single molecule sequencing by synthesis

25. Assembly of short reads 17 bp ATTGTTCCCACAGACCG CGGCGAAGCATTGTTCC ACCGTGTTTTCCGACCG AGCTCGATGCCGGCGAAG TTGTTCCCACAGACCGTG TTTCCGACCGAAATGGC ATGCCGGCGAAGCATTGT ACAGACCGTGTTTCCCGA TAATGCGACCTCGATGCC AAGCATTGTTCCCACAG TGTTTTCCGACCGAAAT TGCCGGCGAAGCCTTGT CCGACCGAAATGGCTCC 66 bp Consensus sequence: TAATGCGACCTCGATGCCGGCGAAGCATTGTTCCCACAGACCGTGTTTTCCGACCGAAATGGCTCC

26. Overview of DNA to RNA to Protein • A gene is expressed in two steps • Transcription: RNA synthesis • Translation: Protein synthesis

27. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene

28. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA RNA: A single-stranded copy of one gene.

29. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. RNA Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons.

30. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Codon 1

31. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Codon 1 Codon 2

32. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Amino acid 2 Amino acid 1 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Codon 1 Codon 2

33. The Central Dogma: DNARNAProtein DNA: A long double-stranded string of nucleotides that encode for many genes. Gene RNA: A single-stranded copy of one gene. Amino acid 2 Amino acid 1 Protein: Proteins are composed amino acids. Amino acids are made from triplets of nucleotides called codons. Codon 1 Codon 2 Protein!

34. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT

35. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met

36. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val

37. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu

38. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser

39. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro

40. A small change in the gene sequence can result in a very different protein DNA: ATG GTG CTG TCT CCT Amino Acids/Protein: Met Val Leu Ser Pro

41. A small change in the gene sequence can result in a very different protein DNA: DNA: ATG GTG CTG TCT CCT ATG GTG CTG TCT ACT Amino Acids/Protein: Met Val Leu Ser Pro

42. A small change in the gene sequence can result in a very different protein DNA: DNA: ATG GTG CTG TCT CCT ATG GTG CTG TCT ACT Amino Acids/Protein: Amino Acids/Protein: Met Met Val Val Leu Leu Ser Ser Thr Pro

43. A small change in the gene sequence can result in a very different protein DNA: DNA: ATG GTG CTG TCT CCT ATG GTG CTG TCT ACT Amino Acids/Protein: Amino Acids/Protein: Met Val Leu Ser Thr Met Val Leu Ser Pro Words: Tom and Sam are bad

44. A small change in the gene sequence can result in a very different protein DNA: DNA: ATG GTG CTG TCT CCT ATG GTG CTG TCT ACT Amino Acids/Protein: Amino Acids/Protein: Met Val Leu Ser Thr Met Val Leu Ser Pro Words: Tom and Sam are bad Words: Tom and Sam are sad

45. A small change in the gene sequence can result in a very different protein DNA: DNA: ATG GTG CTG TCT ACT ATG GTG CTG TCT CCT Amino Acids/Protein: Amino Acids/Protein: Met Val Leu Ser Thr Met Val Leu Ser Pro Words: Tom and Sam are bad Words: Tom and Sam are sad Changes in DNA are called variations or mutations Variations in the DNA (genotype) can cause observable changes (phenotype) in individuals

46. Human Genome Research • Human Genome Project in 2003 • Finishing the euchromatic sequence of the human genome. • Nature 2004; 431 (7011): 931-945. • Phase I HapMap project in 2005 • A haplotype map of the human genome. • Nature 2005: 437(7063):1299-1320 • Encyclopedia of DNA Elements (ENCODE) project in 2007 • Identification and analysis of functional elements in 1% • of the human genome by the ENCODE pilot project. • Nature 2007; 447(7146):799-816 • 1000 Genomes Project in 2008 • DNA sequences. A plan to capture human diversity in 1000 genomes. • Science 2008; 319(5863):395

47. Genotypes and Human Disease Do all humans have the same DNA? • Single nucleotide polymorphisms or SNPs. • We can associate SNPs with medical histories of individuals and achieve statistically significant correlations. • Pharmacogenetics (PGx)is the science of how an individual’s genotype affects their body’s response to drugs.

48. Variationsin our DNA make us UNIQUE!

49. Genomics in Drug Discovery

50. Personalized Medicines • Personalized medicineis the use ofinformation from a patient's genotype to: • Initiate a preventative measure against the development of a disease or condition, • or • Select the most appropriate therapy for a disease or condition that is particularly suited to that patient.