shaina
Uploaded by
1 SLIDES
143 VIEWS
20LIKES

Schematic and Gel Analysis of EcoNI-Digested Plasmids Containing Os11N3 Promoter Variants

DESCRIPTION

This figure illustrates the digestion of plasmid DNA containing the Os11N3 promoter region using EcoNI. Part A presents a schematic of linearized plasmids used in digestion reactions, including pTOP/Os11N3, which contains the wild-type AvrXa7 binding sequence, and pTOP/Os11N3m2, featuring a mutated sequence. Part B shows a gel image of the EcoNI linearized plasmid DNA treated with FN-AvrXa7, indicating expected DNA fragment sizes. Part C details the treatment of linearized plasmids with increasing amounts of FN-AvrXa7, highlighting predicted fragment sizes.

1 / 1

Download Presentation

Schematic and Gel Analysis of EcoNI-Digested Plasmids Containing Os11N3 Promoter Variants

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Figure S3 A EcoNI (2971 bp) EcoNI Os11N3 (0.4 kb) ACTATATAAACCCCCTCCAACCAGGTGCTAAGCTC - - - - - - pTOP/Os11N3 2129 bp ---ACTATcccgggATAAACCCCCTCCAACCAGGTGCTAAGCTC --- pTOP/Os11N3m2 EcoNI EcoNI (3270 bp) pTOP/GFP GFP (0.7 kb) B C M M 1 2 3 kb kb 3.0 * 3.0 2.0 2.0 * * 1.0 1.0 * Os11N3m2 Os11N3 Figure 3. TargetDNA digestion with the FN-AvrXa7 TALN. (A) Schematic of linearized plasmids used in digestion reactions. The plasmid DNA was linearized with EcoNI. pTOP/Os11N3 represents a 400 bp promoter region including the 5’-UTR of Os11N3 (open box) in the pTOPO cloning vector. The AvrXa7 binding sequence for wild type (pTOP/Os11N3) and mutant (pTOP/Os11N3m2) are underlined and in red. The numbers (2129 bp and 2971 bp) indicate the positions of nucleotides relative to the EcoN1 site to the left. pTOP/GFP represents a GFP gene coding sequence cloned into the pTOPO vector used as negative control. (B) Gel image of EcoNI linearized plasmid DNA treated with FN-AvrXa7. M, 1 kb marker; 1, pTOP/Os11N3 with wild type AvrXa7 EBE; 2, mutated pTOP/Os11N3 AvrXa7 EBE; and 3, pTOP/GFP. Asterisks (*) indicate DNA fragment sizes expected if the NF-AvrXa7 TAL effector nuclease cleavage takes place correctly at the AvrXa7 EBE target site in the linearized pTOP/Os11N3. (C) An equal amount (1 ug) of linearized pTOP/Os11N3 and pTOP/Os11N3m2 were treated with increasing amounts (0, 225, 685 and 815 ng) of FN-AvrXa7 in 20 ul reaction solution for 1 hour at 37°C. Arrows to the right indicate predicted fragment sizes.

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer