genome sequencing in the legumes l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Genome Sequencing in the Legumes PowerPoint Presentation
Download Presentation
Genome Sequencing in the Legumes

Loading in 2 Seconds...

play fullscreen
1 / 18

Genome Sequencing in the Legumes - PowerPoint PPT Presentation


  • 159 Views
  • Uploaded on

Genome Sequencing in the Legumes. Le et al. 2007. ~14 MY. ~45 MY. Phylogeny. Major sequencing efforts Minor sequencing efforts. Zhu et al. 2005. Papilionoideae in GenBank. Types of sequencing. Physical map --> Sequence map Traditional--human & Arabidopsis Sequence map --> Physical map

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genome Sequencing in the Legumes' - sela


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
phylogeny

~14 MY

~45 MY

Phylogeny
  • Major sequencing efforts
  • Minor sequencing efforts
types of sequencing
Types of sequencing
  • Physical map --> Sequence map
    • Traditional--human & Arabidopsis
  • Sequence map --> Physical map
    • Drosophila
  • Incomplete sequence map
    • With or without physical information
physical to sequence rice arabidopsis human

Genome

150 kb fragments

Physical to Sequence (rice, Arabidopsis, human)

?

..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt..

BAC library

slide7

fingerprint

Integrate genetic physical map

map based genome sequencing

Minimum Tiling Path

Genetic map

Map-based Genome Sequencing

actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc

Physical map

Chromosome

shotgun sequencing

Soybean chromosomes

scaffold

contig

Shotgun sequencing

  • Lots of contigs/scaffolds
  • Not anchored to genetic map
shotgun genome sequencing

shotgun sequence

Physical map

Genetic map

Shotgun Genome Sequencing

Chromosome

outcomes
Outcomes
  • Map-based approach
    • Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard)
    • Slower, costly
  • Shotgun approach
    • Initially disordered, though can be genetically integrated
    • May or may not have underlying physical map
    • May have assembly problems
    • Fast and less expensive
prerequisites
Prerequisites
  • Understand genome structure
    • Neopolyploidy?
    • Repeat content?
    • Repeat distribution?
    • Comparisons to related genomes. How valuable will they be?
leveraging genomes
Leveraging Genomes
  • Understand and introgress diversity
  • Marker development for selection and gene cloning
  • Basic questions: evolution, genome structure
slide15

Genus Oryza

A - O. rufipogon

B - O. nivara

C - O. glaberrima

how to deal with incompletely sequenced genomes
How to deal with incompletely sequenced genomes
  • Genetic and physical maps/information are imperative
  • Leverage related genomes to aid in assembly
  • Target finishing to regions of interest
    • Genic/QTLs/anchored scaffolds…
  • Low coverage sequencing of MTP or entire BAC library