190 likes | 506 Views
Genome Sequencing in the Legumes. Le et al. 2007. ~14 MY. ~45 MY. Phylogeny. Major sequencing efforts Minor sequencing efforts. Zhu et al. 2005. Papilionoideae in GenBank. Types of sequencing. Physical map --> Sequence map Traditional--human & Arabidopsis Sequence map --> Physical map
E N D
Genome Sequencing in the Legumes Le et al. 2007
~14 MY ~45 MY Phylogeny • Major sequencing efforts • Minor sequencing efforts
Types of sequencing • Physical map --> Sequence map • Traditional--human & Arabidopsis • Sequence map --> Physical map • Drosophila • Incomplete sequence map • With or without physical information
Genome 150 kb fragments Physical to Sequence (rice, Arabidopsis, human) ? ..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt.. BAC library
fingerprint Integrate genetic physical map
Minimum Tiling Path Genetic map Map-based Genome Sequencing actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc Physical map Chromosome
Soybean chromosomes scaffold contig Shotgun sequencing • Lots of contigs/scaffolds • Not anchored to genetic map
shotgun sequence Physical map Genetic map Shotgun Genome Sequencing Chromosome
Outcomes • Map-based approach • Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard) • Slower, costly • Shotgun approach • Initially disordered, though can be genetically integrated • May or may not have underlying physical map • May have assembly problems • Fast and less expensive
Prerequisites • Understand genome structure • Neopolyploidy? • Repeat content? • Repeat distribution? • Comparisons to related genomes. How valuable will they be?
Leveraging Genomes • Understand and introgress diversity • Marker development for selection and gene cloning • Basic questions: evolution, genome structure
Genus Oryza A - O. rufipogon B - O. nivara C - O. glaberrima
How to deal with incompletely sequenced genomes • Genetic and physical maps/information are imperative • Leverage related genomes to aid in assembly • Target finishing to regions of interest • Genic/QTLs/anchored scaffolds… • Low coverage sequencing of MTP or entire BAC library