'Pubx gal4 gfp' presentation slideshows

Pubx gal4 gfp - PowerPoint PPT Presentation


γ GFP

γ GFP

A. PUbx Gal4 > GFP. γ Ubx. B. C. 120. γ Ubx. γ GFP. 100. 100. 80. 80. γ GFP. A1. 60. wt. arm Gal4 > VCU. 60. % of arm expression level. % of wt A1 expression level. γ Ubx. 40. γ GFP. 40. T2. 20. 20. γ Ubx γ GFP. 0. 0. arm Gal4 > VCU (1). PUbx Gal4 > VCU (2). 2.

By karlyn
(127 views)


View Pubx gal4 gfp PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Pubx gal4 gfp PowerPoint presentations. You can view or download Pubx gal4 gfp presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for Pubx gal4 gfp
GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES. CE NE CE NE CE NE. A. GFP-WT Annexin II. GFP. CE CE NE NE. GFP-NES mutant annexin II. B. PGK. PACP - + - +. 1 2 3 4 5 6. GFP-NES. C.

By ama (102 views)

The GAL4 Regulon

The GAL4 Regulon

Simple regulatory systems:. The GAL4 Regulon. + Glucose (= no Galactose). no Glucose + Galactose. Gal3p. Gal3p. Gal4 binds to UAS G sites and regulates genes involved in Galactose metabolism. The dissociation model. The non-dissociation model. TBP. TBP.

By sheila-bentley (282 views)

gfp -

gfp -

Gene correction in trans: a model for gene therapy. gfp -. Luther Davis Jason Cummings Nancy Maizels. Gene correction in trans: a model for gene therapy. GFP +. Luther Davis Jason Cummings Nancy Maizels. nuclease. Gene correction in trans. Cut sites. eGFP. Poly-lacO. Puro. trGFP.

By arnie (128 views)

GFP

GFP

A. MSCV. MSCV. GFP-RV. 5 ‘ LTR. IRES. GFP. 3 ‘ LTR. 3 ‘ LTR. mIFN- . IRES. GFP. IFN/GFP-RV. 5 ‘ LTR. B. GFP-RV IFN/GFP-RV. 35%. 34%. 55%. 56%. CD 8. 2%. 2%. 8%. 8%. GFP. C. GFP-RV IFN/GFP-RV. 99%. 99%.

By marcos (148 views)

GFP

GFP

KIR3DSW08. KIR3DLW03. KIR3DL05. m ock. 2 nd Ab. 1C7. 2H5. PE-Cy5.5. 2H3. 2H9. GFP.

By kanan (105 views)

GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie (125 views)

GFP

GFP

A. Plasmid 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG Full-length 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG

By pilar (149 views)

GFP

GFP

By eden (117 views)

GFP

GFP

T 0. T 8. Untreated. G 1. 46%. 13%. 46%. S. 19%. 11%. 17%. G 2. 35%. 76%. 37%. T 0. T 8. Untreated. G 1. 44%. 8%. 45%. S. 14%. 6%. 16%. G 2. 42%. 86%. 39%. T 0. T 8. Untreated. G 1. 43%. 10%. 46%. S. 16%. 8%. 10%. G 2. 41%. 82%. 44%. GFP. A. B. GFP.

By muncel (92 views)

GFP

GFP

A. Van der Gun et al. B. pMX. ZF A SKD. ZF B VP64. EpCAM. GFP. Supplementary: Figure 1 Bidirectional EpCAM expression modulation. D. Van der Gun et al. C. E. Supplementary: Figure 1 Bidirectional EpCAM expression modulation.

By farica (119 views)