Posterior decoding - PowerPoint PPT Presentation

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Stochastic Context Free Grammars. In an analogy to HMMs, we can assign probabilities to transitions: Given grammar

★ ★ ★ ★ ★

465 views • 30 slides

Multiple Alignment of Citation Sentences with Conditional Random Fields and Posterior Decoding

Multiple Alignment of Citation Sentences with Conditional Random Fields and Posterior Decoding. Ariel Schwartz, Anna Divoli, and Marti Hearst University of California, Berkeley Supported in part by NSF DBI 0317510. Bioscience literature. Rich, complex and fast growing.

★ ★ ★ ★ ★

354 views • 27 slides

View Posterior decoding PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Posterior decoding PowerPoint presentations. You can view or download Posterior decoding presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.