'Open reading frames' presentation slideshows

NEGATIVE STRAND RNA VIRUSES

NEGATIVE STRAND RNA VIRUSES. (-) sense RNA genome: Genomic RNA is not translatable. Viral RNA is transcribed into (+)sense mRNA. RNA alone is not infectious. Virions contain RNA dependent RNA polymerase. Most, if not all viruses are enveloped.

938 views • 47 slides

Gene Structure Prediction (Gene Finding)

I519 Introduction to Bioinformatics, 2012. Gene Structure Prediction (Gene Finding). Gene prediction.

974 views • 43 slides

The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or a

The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or animal kingdoms. The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or animal kingdoms

614 views • 36 slides

The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or a

The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or animal kingdoms. The Structure & Complexity of Virus Genomes more varied than any of those seen in the entire bacterial, plant or animal kingdoms

482 views • 36 slides

Basic Bioinformatics

Basic Bioinformatics. As it is applied to the Bacillus megaterium genome . What we are going to talk about. Why we are doing all this DNA sequencing What genes look like and where they are found How we can compare sequences between different species How genes move between species.

516 views • 30 slides

Systems Biology Study Group

449 views • 26 slides

Genome analysis

Bioinformatics. Genome analysis. Contents. Genome annotation Comparative genomics Phylogenetic profiles Gene fusion analysis Phylogenetic footprinting. Bioinformatics. From sequences to genomes. From sequences to genomes.

478 views • 25 slides

Genome Annotation

521 views • 24 slides

FAMILY CALICIVIRIDAE: Noroviruses

FAMILY CALICIVIRIDAE: Noroviruses. Teresa Kunkel 4-16-04 Honors Virology Presentation. To Be Discussed:. Taxonomy, structure and genome Disease manifestations and clinical symptoms Diagnosis Transmission Epidemiology and incidence Environmental resistance Prevention and Control.

337 views • 23 slides

FAMILY CALICIVIRIDAE: Noroviruses

FAMILY CALICIVIRIDAE: Noroviruses. To Be Discussed:. Taxonomy, structure and genome Disease manifestations and clinical symptoms Diagnosis Transmission Epidemiology and incidence Environmental resistance Prevention and Control. Noroviruses Taxonomy. Previously- Family Caliciviridae

736 views • 22 slides

Finding substrings

Finding substrings. my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }. Finding substrings. my $sequence = " gatgcaggctcgctagcggct"; #Does this string contain a startcodon ?

290 views • 21 slides

Project presentation using TWiki

Project presentation using TWiki . Lim Yun Ping National University of Singapore. What is a wiki ?. Definitions of Wiki on the Web:

367 views • 18 slides

Heterologous Membrane Protein Expression and Purification from Pyrococcus furiosus

Heterologous Membrane Protein Expression and Purification from Pyrococcus furiosus. Han-Seung Lee , Michi Izumi, Francis E. Jenney Jr, Farris Poole, Frank Sugar, Claudia Shah, Michael W.W. Adams. Southeast Collaboratory for Structural Genomics (SECSG), University of Georgia, .

428 views • 15 slides

Ebola Hemorrhagic Fever

Ebola Hemorrhagic Fever. Anderson Coates Michael Mastropole. Discovery. Three initial outbreaks 1976 in Sudan E. Sudan 1976 in the Democratic Republic of the Congo E. Zaire 1979 in Sudan E. Sudan Outbreak occurred in the same factory as first outbreak. Virus Strains.

293 views • 13 slides

Clinical Group

Clinical Group. Biology of HIV infection by Duangrat Inthorn Mechanism of Reverse Transcriptase Inhibitors and Protease Inhibitors by Tawitch Suriyo Animal Models for HIV by Pornpat Intarasunanont. Clinical Group (continue). Clinical Trails- Crixivan by Somjed Sahasitiwat

126 views • 12 slides

String ($ var ) arrays (@array) conversion and substring extraction

String ($ var ) arrays (@array) conversion and substring extraction. Lecture 6. Split strings. This function can be used to split (divide) data: Strings into an arrays. Strings into a list of scalars ($variables)

183 views • 7 slides