'Multiplex pcr' presentation slideshows

RECOMBINANT DNA TECHNIQUES and PROTEIN ENGINEERING

RECOMBINANT DNA TECHNIQUES and PROTEIN ENGINEERING. Polymerase chain reaction. Polymerase chain reaction. Kary B. Mullis, Cetus, 1985, 1993 http://www.nobel.se/chemistry/laureates/1993/mullis-lecture.html

665 views • 54 slides

OXA and relevant superbugs

892 views • 50 slides

Combinatorial Optimization Methods for Reliable Genomic-Based Detection Systems

Combinatorial Optimization Methods for Reliable Genomic-Based Detection Systems. Ion Mandoiu University of Connecticut Computer Science & Engineering Department. Motivation.

596 views • 48 slides

Muscular dystrophy

Muscular dystrophy. Dr. Derakhshandeh. Muscular dystrophy (MD). a group of rare inherited muscle diseases muscle fibers are unusually susceptible to damage Muscles, primarily voluntary muscles, become progressively weaker

578 views • 43 slides

Closer to the front door: clinical aspects of Microbiology automation

Closer to the front door: clinical aspects of Microbiology automation. Dr David Garner BM MSc MRCPCH FRCPath Frimley Health NHS Foundation Trust & Surrey Pathology Services. Biography. Background in paediatrics before training in Microbiology in Nottingham, UK

431 views • 42 slides

DNA barcoding for disease vectors

DNA barcoding for disease vectors . Daniel Adjei Boakye Parasitology Department Noguchi Memorial Institute for Medical Research. elephantiasis. Lymphatic filariasis. Onchocerciasis. Health and Socio-economic impact. Leishmaniasis. Impact of parasitic diseases. Cause immense suffering

378 views • 22 slides

446 views • 22 slides

224 views • 22 slides

Genome closure and finishing

Genome closure and finishing. Clone walking. clone insert (from shotgun library). primer locations. Already sequenced. Unsequenced. sequencing primer. direction of extension. tgcatgatcgtgatcat acgtactagcactagtactgtagtcgatgcactgatcgatcgatcgatgctacgatgcatgct. PCR to close gaps. Scaffold.

296 views • 21 slides

Evaluation of the genetic impact on inflammatory bowel disease

Evaluation of the genetic impact on inflammatory bowel disease. Natalie Bibb Trainee Project KGC. Presentation aims. Overview of inflammatory bowel disease (IBD) Purpose of project Genome-wide association studies (GWAS) and identification of IBD susceptibility genes Pathogenesis of IBD

359 views • 20 slides

Molecular identification of fish species

Molecular identification of fish species. Traditional fish taxonomy. based on external morphological features , including body shape, pattern of colors , scale size and count, number and relative position of fins, number and type of fin rays, or various relative measurements of body parts

1.13k views • 19 slides

PCR Polymerase Chain Reaction

901 views • 17 slides

PCR Polymerase Chain Reaction

439 views • 17 slides

Fundamentals of Forensic DNA Typing

131 views • 12 slides

Forensic Biology by Richard Li

Chapter 14: DNA Amplification by Polymerase Chain Reaction. Forensic Biology by Richard Li. Basic Principles. Polymerase Chain Reaction (PCR) Exponential amplification of specific sequences of DNA to yield sufficient amplified product: Amplicons Highly sensitive Can amplify small quantities

292 views • 8 slides