'Linux commands' presentation slideshows

Your Home Directory

Your Home Directory. When you login to the server, you always start in your Home directory. Create sub-directories to store specific projects or groups of information, just as you would place folders in a filing cabinet.

1.21k views • 93 slides

Neuroimaging on the Shared Computing Cluster (SCC)

Neuroimaging on the Shared Computing Cluster (SCC). Dustin Clark clarkdc@bu.edu Research Computing Services Information Services & Technology Boston University. Goals. Learn how to use the SCC for neuroimaging analysis. Connect to the SCC Move data onto the SCC Unpack Data FreeSurfer

846 views • 68 slides

Bioinformatics ?????????? ??? jtang@cse.sc 13928761660

Bioinformatics ?????????? ??? jtang@cse.sc.edu 13928761660. www.cse.sc.edu/~jtang/BJFU. ??. GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATTAATAAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCTGAA ?????? blast ????????????? ??????? pubmed ??????.

711 views • 59 slides

Short Read Sequencing Analysis Workshop

560 views • 55 slides

Linux Basic

Linux Basic. TA for ITIS3100: Xu Fei fxu@uncc.edu 2008-01. Agenda. Linux Basic What is Linux Linux Kernel Linux Family Map Linux distribution Example User Interfaces: GUI and CLI Linux Commands Basic Linux File System Directory Relationship File Permission

537 views • 31 slides

Using Linux Commands

Using Linux Commands. Lab 3. Using the Shell in Linux Commands Syntax. Options: could be added to the commands to change their behavior (-a , -la , --help) Argument: is an extra piece of information (ex.: a file name) Environment variables :

376 views • 26 slides

Using Linux Commands

Using Linux Commands. Lab 4. Checking directories and permissions. To find out what your current directory is: To find out the name of your home directory:. To get back to your home directory: To change the current directory to the directory that you choose:.

303 views • 19 slides

What's a command? It's a binary file kept under specific directory.

Frequently Used Linux Commands. What's a command? It's a binary file kept under specific directory. vi editor modes in vi editor Command insert esc key to switch between modes. mostly used commands: vi filename.c :x :q! shift+a - append. File handling commands. Manipulating Files:

316 views • 15 slides

The Applied Mathematics Research Lab Located in CAS 240 (330).972.6776 (x6776 on campus)

The Applied Mathematics Research Lab Located in CAS 240 (330).972.6776 (x6776 on campus) Administrator: Zach Tocchi ( amrladmins@uakron.edu ) Website: http://www.amrl.uakron.edu/. One of the first networks on campus, if not the first network

269 views • 15 slides

More on Using onyx

More on Using onyx. 8/28/13. Program 1. Due a week from today. See website for details. Objectives. Review using vim Learn more Linux commands. Steps to Run a C++ program. Login into onyx Edit the program using vi or vim Compile the program with g++ Execute the program with a.out

264 views • 13 slides

Using Linux Commands

Using Linux Commands. Lab 3. Checking system activity. To list running processes and monitoring system usage: a option ask to show process of all users who are associated with your current terminal

278 views • 12 slides

Lab 1 introduction, debrief

116 views • 11 slides

???????????? Computation Theory of Operating System Interpreter

???????????? Computation Theory of Operating System Interpreter. CE6114 ???. Books. A Practical Guide to Linux Commands, Editors, and Shell Programming Authors: Mark G. Sobell Publisher: Prentice Hall. Contents:. Introduction Command Line Utilities The Linux File System The Shell

45 views • 4 slides