Linear space - PowerPoint PPT Presentation
Space Efficient Alignment Algorithms
Space Efficient Alignment Algorithms. Dr. Nancy Warter-Perez. Outline. Algorithm complexity Complexity of dynamic programming alignment algorithms Hirschberg’s Divide and Conquer algorithm. Algorithm Complexity. Indicates the space and time (computational) efficiency of a program
By vivian
Digital Image Processing
Digital Image Processing. STMIK MDP. Image Distortion Model. Restoration depends on distortion Common model: convolve plus noise Special case: noise alone (no convolution). Thoughts on Restoration. Enhancement vs restoration Enhancement: cosmetic Restoration: substantive
By mariah
CAP5510 – Bioinformatics Sequence Comparison
CAP5510 – Bioinformatics Sequence Comparison. Tamer Kahveci CISE Department University of Florida. Goals. Understand major sequence comparison algorithms. Gain hands on experience. Why Compare Sequences ?. Prediction of function Construction of phylogeny Shotgun sequence assembly
By moshe
Sequence Alignment Cont’d
Sequence Alignment Cont’d. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC. - AG G CTATCAC CT GACC T C CA GG C CGA -- TGCCC --- T AG - CTATCAC -- GACC G C -- GG T CGA TT TGCCC GAC. Definition Given two strings x = x 1 x 2 ...x M , y = y 1 y 2 …y N ,
By beyla
Heuristic alignment algorithms; Cost matrices
Heuristic alignment algorithms; Cost matrices. 2.5 – 2.9 Thomas van Dijk. Content. Dynamic programming Improve to linear space Heuristics for database searches BLAST, FASTA Statistical significance What the scores mean Score parameters (PAM, BLOSUM). Dynamic programming.
By donar
L3: Blast: Keyword match basics
L3: Blast: Keyword match basics. Silly Quiz. TRUE or FALSE: In New York City at any moment, there are 2 people (not bald) with exactly the same number of hairs!. Assignment 1 is online. Due 10/6 (Thursday) in class. An O(nm) algorithm for score computation. For i = 1 to n
By neviah
Sequence Alignment
Sequence Alignment. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC. - AG G CTATCAC CT GACC T C CA GG C CGA -- TGCCC --- T AG - CTATCAC -- GACC G C -- GG T CGA TT TGCCC GAC. Definition Given two strings x = x 1 x 2 ...x M , y = y 1 y 2 …y N ,
By duane
Linear-Space Alignment
Linear-Space Alignment. Subsequences and Substrings. Definition A string x’ is a substring of a string x, if x = ux’v for some prefix string u and suffix string v (similarly, x’ = x i …x j , for some 1 i j |x|) A string x’ is a subsequence of a string x
By benita
Linear-Space Alignment
Linear-Space Alignment. Subsequences and Substrings. Definition A string x’ is a substring of a string x, if x = ux’v for some prefix string u and suffix string v (similarly, x’ = x i …x j , for some 1 i j |x|) A string x’ is a subsequence of a string x
By winona
The Complexity of Tree Transducer Output Languages
The Complexity of Tree Transducer Output Languages. FSTTCS 2008, Bengaluru. The Univ. of Tokyo Kazuhiro Inaba NICTA, and UNSW Sebastian Maneth. “Complexity of Output Languages”. Given… A language L ⊆ T Σ (Trees over Σ)
By rea
I/O-Efficient Structures for Orthogonal Range Max and Stabbing Max Queries
I/O-Efficient Structures for Orthogonal Range Max and Stabbing Max Queries. Second Year Project Presentation Ke Yi Advisor: Lars Arge Committee: Pankaj K. Agarwal and Jun Yang. Problem Definition: Range Max Queries. Range-aggregate queries : range-count, range-sum, range-max
By coye
Sequence Alignment Cont’d
Sequence Alignment Cont’d. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC. - AG G CTATCAC CT GACC T C CA GG C CGA -- TGCCC --- T AG - CTATCAC -- GACC G C -- GG T CGA TT TGCCC GAC. Definition Given two strings x = x 1 x 2 ...x M , y = y 1 y 2 …y N ,
By rendor
Sequence Alignment
Sequence Alignment. Tanya Berger-Wolf CS502: Algorithms in Computational Biology January 25, 2011. Comparing Genes in Two Genomes. Small islands of similarity corresponding to similarities between exons Such comparisons are quite common in biology research. String Similarity.
By wylie
A Linear Space Algorithm for Computing Maximal Common Subsequences
A Linear Space Algorithm for Computing Maximal Common Subsequences. Author : D.S. Hirschberg Publisher: Communications of the ACM 1975 Presenter: Han-Chen Chen Date: 2010/04/07. Outline. Introduction Algorithm A Algorithm B Algorithm C. Introduction.
By cinnamon-mitchell
Presented by Daniel Khashabi
Pattern-independent Demosaicing ;. Presented by Daniel Khashabi Joint work with Sebastian Nowozin, Jeremy Jancsary, Andrew W. Fitzgibbon and Bruce Lindbloom. Outline. Demosaicing problem Creating input-output pairs Our demosaicing model Experiments. Raw Spcae.
By gil-cain
Process_Memory_Allocation
Process_Memory_Allocation. Yuan Lin 20130128. Step 1: Generate PE File (After Compile & Link ). Header. Section Table. Section .text. Section .data. Section . bss. ……. PE File Format. Step 2 : Execute PE File. 1GB. Kernel Space. Parameter & Environ. Stack. ……. Linear Space
By willoughby-roland
Sequence Alignment Cont’d
Sequence Alignment Cont’d. Evolution. Scoring Function. Sequence edits: AGGCCTC Mutations AGG A CTC Insertions AGG G CCTC Deletions AGG . CTC Scoring Function: Match: +m Mismatch: -s Gap: -d
By callum-levy
Sequence Alignment
Sequence Alignment. Lecture 2, Thursday April 3, 2003. Review of Last Lecture. Lecture 2, Thursday April 3, 2003. Sequence conservation implies function. Interleukin region in human and mouse. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC.
By shellie-kelly
Linear-Space Alignment
Linear-Space Alignment. Subsequences and Substrings. Definition A string x’ is a substring of a string x, if x = ux’v for some prefix string u and suffix string v (similarly, x’ = x i …x j , for some 1 i j |x|) A string x’ is a subsequence of a string x
By rana-hanson
Math 307 Spring, 2003 Hentzel Time: 1:10-2:00 MWF Room: 1324 Howe Hall
Math 307 Spring, 2003 Hentzel Time: 1:10-2:00 MWF Room: 1324 Howe Hall Instructor: Irvin Roy Hentzel Office 432 Carver Phone 515-294-8141 E-mail: hentzel@iastate.edu http://www.math.iastate.edu/hentzel/class.307.ICN Text: Linear Algebra With Applications,
By india-carlsonView Linear space PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Linear space PowerPoint presentations. You can view or download Linear space presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.