'Linear space' presentation slideshows

1.3k views • 106 slides

Digital Image Processing

Digital Image Processing. STMIK MDP. Image Distortion Model. Restoration depends on distortion Common model: convolve plus noise Special case: noise alone (no convolution). Thoughts on Restoration. Enhancement vs restoration Enhancement: cosmetic Restoration: substantive

742 views • 62 slides

Heuristic alignment algorithms; Cost matrices

729 views • 53 slides

Math 307 Spring, 2003 Hentzel Time: 1:10-2:00 MWF Room: 1324 Howe Hall

Math 307 Spring, 2003 Hentzel Time: 1:10-2:00 MWF Room: 1324 Howe Hall Instructor: Irvin Roy Hentzel Office 432 Carver Phone 515-294-8141 E-mail: hentzel@iastate.edu http://www.math.iastate.edu/hentzel/class.307.ICN Text: Linear Algebra With Applications,

563 views • 41 slides

511 views • 40 slides

Sequence Alignment

Sequence Alignment. Lecture 2, Thursday April 3, 2003. Review of Last Lecture. Lecture 2, Thursday April 3, 2003. Sequence conservation implies function. Interleukin region in human and mouse. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC.

526 views • 39 slides

556 views • 35 slides

L3: Blast: Keyword match basics

L3: Blast: Keyword match basics. Silly Quiz. TRUE or FALSE: In New York City at any moment, there are 2 people (not bald) with exactly the same number of hairs!. Assignment 1 is online. Due 10/6 (Thursday) in class. An O(nm) algorithm for score computation. For i = 1 to n

511 views • 35 slides

408 views • 35 slides

Sequence Alignment

402 views • 32 slides

Linear-Space Alignment

466 views • 30 slides

Linear-Space Alignment

438 views • 30 slides

Linear-Space Alignment

398 views • 30 slides

The Complexity of Tree Transducer Output Languages

347 views • 27 slides

Presented by Daniel Khashabi

Pattern-independent Demosaicing ;. Presented by Daniel Khashabi Joint work with Sebastian Nowozin, Jeremy Jancsary, Andrew W. Fitzgibbon and Bruce Lindbloom. Outline. Demosaicing problem Creating input-output pairs Our demosaicing model Experiments. Raw Spcae.

493 views • 22 slides

Sequence Alignment

Sequence Alignment. Tanya Berger-Wolf CS502: Algorithms in Computational Biology January 25, 2011. Comparing Genes in Two Genomes. Small islands of similarity corresponding to similarities between exons Such comparisons are quite common in biology research. String Similarity.

305 views • 21 slides

I/O-Efficient Structures for Orthogonal Range Max and Stabbing Max Queries

I/O-Efficient Structures for Orthogonal Range Max and Stabbing Max Queries. Second Year Project Presentation Ke Yi Advisor: Lars Arge Committee: Pankaj K. Agarwal and Jun Yang. Problem Definition: Range Max Queries. Range-aggregate queries : range-count, range-sum, range-max

477 views • 17 slides

A Linear Space Algorithm for Computing Maximal Common Subsequences

A Linear Space Algorithm for Computing Maximal Common Subsequences. Author : D.S. Hirschberg Publisher: Communications of the ACM 1975 Presenter: Han-Chen Chen Date: 2010/04/07. Outline. Introduction Algorithm A Algorithm B Algorithm C. Introduction.

382 views • 16 slides

Space Efficient Alignment Algorithms

438 views • 10 slides

Process_Memory_Allocation

149 views • 7 slides