'Intron 2 size' presentation slideshows

Intron 2 size - PowerPoint PPT Presentation


0.5

0.5

A. 2.5. 2. 1.5. 1. 0.5. 0. 0. 500. 1000. 1500. 2000. 2500. 3000. 3500. size of Intron 2 in orthologouse MYB10 gene. Intron 2 (from 82 bp to 3000 bp). Intron 1. Exon 2. Exon 1. Exon 3. 100~130. 83~ 371. 130. 264~2981. 415~517. B. C. Additional file 1

By shannon-dominguez
(89 views)


View Intron 2 size PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Intron 2 size PowerPoint presentations. You can view or download Intron 2 size presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for Intron 2 size
Fungal Genome Size and Intron Evolution

Fungal Genome Size and Intron Evolution

Figures Only, Tables will be in the manuscript word file. Fungal Genome Size and Intron Evolution. Kemin Zhou, Oct 4, 2012. 400. 100. Batde5. ustma1. 350. 300. 80. 250. 200. 60. Sporo1. 150. 100. 40. 50. 0. 20. 40. 60. 80. 100. 0. 20. 40. 60. 80. 100. 0. 20. 40. 60.

By iona (73 views)

Intron Growth

Intron Growth

Intron Growth. Insertions and Deletions of Introns in Human and Dog Sharndeep Kaur March 15, 2005 Bme 230. Topic- growth pattern. The focus of my project was to determine the pattern of insertions/deletions of introns in human and dog over evolution.

By sonia-alvarado (81 views)

Excision of Intron Sequences

Excision of Intron Sequences

Excision of Intron Sequences. Splicing. Removal of introns must be very precise. Conserved sequences for removal of the introns of nuclear mRNA genes are minimal. Dinucleotide sequences at the 5 ’ and 3 ’ ends of introns.

By larissa-ayers (65 views)

intron classes distribution

intron classes distribution

By MikeCarlo (226 views)

Intron Evolution Supplemental

Intron Evolution Supplemental

Intron Evolution Supplemental. Kemin Zhou Jan 14, 2011. 0.1. 7.29. Basidiomycota. cryneo1. 7.32. Agaricomycetes. copci1. 7.89. Lacbi1. 7.21. Tremellomycetes. Pospl1. Sporo1. 6.90. 7.08. Phchr1. Pucciniomycotina. Batde5. 5.9. Agaricomycotina. Chytridiomycota. 1.68. 80.

By camden-britt (127 views)

Additional File 2 Intron conservation and divergence.

Additional File 2 Intron conservation and divergence.

Additional File 2 Intron conservation and divergence. The wheat LKR/SDH introns were concatenated into a single contiguous sequence and used to compare to the Brachypodium (A) and

By shaine-villarreal (73 views)

Intron and Exon in Eukaryotic Cells

Intron and Exon in Eukaryotic Cells

Intron and Exon in Eukaryotic Cells. exon. exon. exon. intron. intron. 5’. 3’. 5’. 3’. DNA. promotor. stop codon. start codon. Transcription. mRNA. Processing. cap. poly A tail. Splicing. Intron deleted. mature mRNA. To cytoplasm. Take place in nucleus.

By ban (188 views)

(chr19:1,219,777-1,219,838 shown) AluY in intron 3

(chr19:1,219,777-1,219,838 shown) AluY in intron 3

AluJr in intron 1 (chr19:1,212,912-1,212,973 shown). ACCTTAAGTAATCCTCTCTG GCCTCCCAAAGTGCTGGGATTACAGG TGTAAGCCATAGTACT. CTCGTGATCCGCCTGCCTCA GCCTCCCAAAGTGCTGGGATTACAGG CATGAGCTACCACGCC. (chr19:1,219,777-1,219,838 shown) AluY in intron 3.

By morrie (86 views)