'Indicator cells gfp mfi' presentation slideshows

Indicator cells gfp mfi - PowerPoint PPT Presentation


Supplementary Figure 2

Supplementary Figure 2

Supplementary Figure 2. Week 1. Week 2. Indicator Cells GFP MFI.

By garin
(85 views)


View Indicator cells gfp mfi PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Indicator cells gfp mfi PowerPoint presentations. You can view or download Indicator cells gfp mfi presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for Indicator cells gfp mfi
GFP silencing reverted cells

GFP silencing reverted cells

Figure 1A. Vectors employed. Control line. Experimental line-1. Experimental line-2. GFP silencing reverted cells. Sf21 cell. GFP expressing cells. X. GFP silenced cells. Figure 1B. gfp shRNA Forward primer. gfp shRNA (49 bp). a. EcoRI. KpnI. 19 bp. 9 bp. 19 bp. gfp shRNA

By eileen (87 views)

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES. CE NE CE NE CE NE. A. GFP-WT Annexin II. GFP. CE CE NE NE. GFP-NES mutant annexin II. B. PGK. PACP - + - +. 1 2 3 4 5 6. GFP-NES. C.

By ama (102 views)

SSTR3-GFP-Rosa26 ES Cells +Cre virus

SSTR3-GFP-Rosa26 ES Cells +Cre virus

Rosa Targeting Approach for Inducible Gene Expression. Rosa Targeting Vector. SSTR3-GFP-Rosa26 ES Cells +Cre virus. Clone A2. Clone F3. Cilia. Cilia. Live Imaging in the Kidney -EIIaCre. movie. Tufts of cilia on cells of the Choroid Plexus imaged live (EIIa-Cre).

By arista (115 views)

gfp -

gfp -

Gene correction in trans: a model for gene therapy. gfp -. Luther Davis Jason Cummings Nancy Maizels. Gene correction in trans: a model for gene therapy. GFP +. Luther Davis Jason Cummings Nancy Maizels. nuclease. Gene correction in trans. Cut sites. eGFP. Poly-lacO. Puro. trGFP.

By arnie (128 views)

GFP

GFP

A. MSCV. MSCV. GFP-RV. 5 ‘ LTR. IRES. GFP. 3 ‘ LTR. 3 ‘ LTR. mIFN- . IRES. GFP. IFN/GFP-RV. 5 ‘ LTR. B. GFP-RV IFN/GFP-RV. 35%. 34%. 55%. 56%. CD 8. 2%. 2%. 8%. 8%. GFP. C. GFP-RV IFN/GFP-RV. 99%. 99%.

By marcos (148 views)

GFP

GFP

KIR3DSW08. KIR3DLW03. KIR3DL05. m ock. 2 nd Ab. 1C7. 2H5. PE-Cy5.5. 2H3. 2H9. GFP.

By kanan (105 views)

GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie (125 views)

GFP

GFP

A. Plasmid 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG Full-length 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG

By pilar (149 views)

GFP

GFP

By eden (117 views)

GFP

GFP

T 0. T 8. Untreated. G 1. 46%. 13%. 46%. S. 19%. 11%. 17%. G 2. 35%. 76%. 37%. T 0. T 8. Untreated. G 1. 44%. 8%. 45%. S. 14%. 6%. 16%. G 2. 42%. 86%. 39%. T 0. T 8. Untreated. G 1. 43%. 10%. 46%. S. 16%. 8%. 10%. G 2. 41%. 82%. 44%. GFP. A. B. GFP.

By muncel (92 views)