'Gfp sirna' presentation slideshows

Gfp sirna - PowerPoint PPT Presentation


Vehicle Stat3 siRNA

Vehicle Stat3 siRNA

A. Synthetic siRNA against STAT3. 5’-CAU CUG CCU AGA UCG GCU AdTdT-3’ 3’-dTdT GUA GAC GGA UCU AGC CGA U- 5’. Vehicle Stat3 siRNA GFP siRNA. Vehicle Stat3 siRNA GFP siRNA. Vehicle Stat3 siRNA. B. a -STAT3 a - b -actin. a -STAT3 a -MAPK. A172. U251. NHA. C.

By naasir
(165 views)


View Gfp sirna PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Gfp sirna PowerPoint presentations. You can view or download Gfp sirna presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for Gfp sirna
Contrl siRNA + - PIK3R3 siRNA - +

Contrl siRNA + - PIK3R3 siRNA - +

Supplemental Figure 2. Contrl siRNA + - PIK3R3 siRNA - +. A. B. PIK3R3. actin. C. Control siRNA PIK3R3 siRNA. D. Control siRNA. PIK3R3 siRNA. Brdu -FITC. Annexin -V. 2.9%. 2.58%. 7-ADD. PI.

By bevan (122 views)

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES

GFP GFP-WT GFP-NES. CE NE CE NE CE NE. A. GFP-WT Annexin II. GFP. CE CE NE NE. GFP-NES mutant annexin II. B. PGK. PACP - + - +. 1 2 3 4 5 6. GFP-NES. C.

By ama (102 views)

Nonspecific siRNA Noxa siRNA

Nonspecific siRNA Noxa siRNA

p < 0.01. Nonspecific siRNA Noxa siRNA. Supplemental Figure 4. Noxa mediates synergism by the ABT-737/etoposide combination. UM-22A cells were transfected with 100 nM Noxa siRNA (5’-GUAAUUAUUGACACAUUUCTT-3’)

By papina (112 views)

Control siRNA BRG1 siRNA

Control siRNA BRG1 siRNA

Supplemental data S1. SW480. Control siRNA BRG1 siRNA. PTEN – Akt – p-Akt – p-GSK-3 b – Cyclin D1 – BRG1 – b -actin –.

By primavera-ruiz (74 views)

gfp -

gfp -

Gene correction in trans: a model for gene therapy. gfp -. Luther Davis Jason Cummings Nancy Maizels. Gene correction in trans: a model for gene therapy. GFP +. Luther Davis Jason Cummings Nancy Maizels. nuclease. Gene correction in trans. Cut sites. eGFP. Poly-lacO. Puro. trGFP.

By arnie (128 views)

GFP

GFP

A. MSCV. MSCV. GFP-RV. 5 ‘ LTR. IRES. GFP. 3 ‘ LTR. 3 ‘ LTR. mIFN- . IRES. GFP. IFN/GFP-RV. 5 ‘ LTR. B. GFP-RV IFN/GFP-RV. 35%. 34%. 55%. 56%. CD 8. 2%. 2%. 8%. 8%. GFP. C. GFP-RV IFN/GFP-RV. 99%. 99%.

By marcos (148 views)

GFP

GFP

KIR3DSW08. KIR3DLW03. KIR3DL05. m ock. 2 nd Ab. 1C7. 2H5. PE-Cy5.5. 2H3. 2H9. GFP.

By kanan (105 views)

GFP

GFP

A. B. 5 ’- LTR. U6.2. shRNA. CMV. GFP. shRNA CONSTRUCT Scrambled GGATCCC GACGATTCGAGGCGCAGTGAT TTGATATCCG ATCACTGCGCCTCGAATCGT CTTTTTTCCAACTCGAG Cyp2b-KD2 GGATCCC AAGAACACTGAGGTGTACCCC TTGATATCCG GGGGTACACCTCAGTGTTCTT TTTTTTCCAACTCGAG

By nonnie (125 views)

GFP

GFP

A. Plasmid 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG Full-length 1 GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCTCGAAATTGTAAAAAGCGGACCG

By pilar (149 views)

GFP

GFP

By eden (117 views)