100+ Gene finding genome PowerPoint (PPT) Presentations, Gene finding genome PPTs

Gene finding genome - PowerPoint PPT Presentation

Gene Prediction and Annotation techniques Basics

Gene Prediction and Annotation techniques Basics. Chuong Huynh NIH/NLM/NCBI Sept 30, 2004 huynh@ncbi.nlm.nih.gov. Acknowledgement: Daniel Lawson, Neil Hall. GATCGGTCGAGCGTAAGCTAGCTAG ATCGATGATCGATCGGCCATATATC ACTAGAGCTAGAATCGATAATCGAT CGATATAGCTATAGCTATAGCCTAT. What is gene prediction?.

★ ★ ★ ★ ★

528 views • 49 slides

View Gene finding genome PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Gene finding genome PowerPoint presentations. You can view or download Gene finding genome presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Gene finding genome' presentation slideshows

Gene finding genome - PowerPoint PPT Presentation

Gene Prediction and Annotation techniques Basics