'Est sequences' presentation slideshows

Est sequences - PowerPoint PPT Presentation


Diterpene synthases

Diterpene synthases

Diterpene synthases. Monoterpene synthases. Sesquiterpene synthases.

By lefty
(167 views)

Bioinformatics for the Canadian Potato Genome Project

Bioinformatics for the Canadian Potato Genome Project

Bioinformatics for the Canadian Potato Genome Project. David De Koeyer, Martin Lagü e and Rebecca Griffiths Wageningen September 18, 2004. Canadian Potato Genome Project. Research Areas. Genomics Operations: EST sequence generation (100,000). Expression Analysis: Microarray profiling.

By zlhna
(228 views)

Efficient Clustering of Large EST Data Sets on Parallel Computers

Efficient Clustering of Large EST Data Sets on Parallel Computers

Efficient Clustering of Large EST Data Sets on Parallel Computers. CECS 694-04 Bioinformatics Journal Club September 17, 2003 Nucleic Acids Research , 2003 , 31 (11), 2963-2974 Presented by Elizabeth Cha. Problem Statement.

By forest
(156 views)

BLAST Sequences queried against the nr or grass databases. GO ANALYSIS

BLAST Sequences queried against the nr or grass databases. GO ANALYSIS

Next Generation Sequencing On Species Important to the Turfgrass Industry Keenan Amundsen 1,2 , Geunhwa Jung 3 , Dilip Lakshman 2 , Scott Warnke 2 1 George Mason University, 2 United States Department of Agriculture, 3 University of Massachusetts. SAMPLE PREPARATION

By infinity
(132 views)

Computational Genomics

Computational Genomics

Computational Genomics. Izabela Makalowska July 15, 2006. The main task in modern biology is to find out how this…. TGCATCGATCGTAGCTAGCTAGCGCATGCTAGCTAGCTAGCTAGCTACGATGCATCG TGCATCGATCGATGCATGCTAGCTAGCTAGCTAGCATGCTAGCTAGCTAGCTATTGG CGCTAGCTAGCATGCATGCATGCATCGATGCATCGATTATAAGCGCGATGACGTCAG

By spiro
(147 views)

Paola Bonizzoni Graziano Pesole * Raffaella Rizzi

Paola Bonizzoni Graziano Pesole * Raffaella Rizzi

A Method to Detect Gene Structure and Alternative Splice Sites by Agreeing ESTs to a Genomic Sequence. Paola Bonizzoni Graziano Pesole * Raffaella Rizzi DISCo, University of Milan-Bicocca, Italy * Department of Physiology and Biochemistry, University of Milan, Italy

By edolie
(140 views)

Genomics data

Genomics data

Genomics data. Production and databasing of genome and transcriptome sequences. Sequencing projects. Human genome : consortium of international centers Bacterial genomes : usually single centers Non-human eukaryotes C. elegans , yeast , Drosophila , Arabidopsis : finished

By jimbo
(112 views)

Introduction of NLM Databases

Introduction of NLM Databases

Introduction of NLM Databases. dbEST Expressed Sequence Tag Database. S.MohammadZad & M. Safari; Graduate Students of MLIS. WHAT IS dbEST ? ( E xpressed S equence T ags). The EST database is a collection of short single-read transcript sequences from GenBank.

By brendan-wagner
(130 views)

Bioinformatics for the Canadian Potato Genome Project

Bioinformatics for the Canadian Potato Genome Project

Bioinformatics for the Canadian Potato Genome Project. David De Koeyer, Martin Lagü e and Rebecca Griffiths Wageningen September 18, 2004. Canadian Potato Genome Project. Research Areas. Genomics Operations: EST sequence generation (100,000). Expression Analysis: Microarray profiling.

By elainegreene
(0 views)


View Est sequences PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Est sequences PowerPoint presentations. You can view or download Est sequences presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.