'Deduced amino acid sequences' presentation slideshows

Deduced amino acid sequences - PowerPoint PPT Presentation


Molecular Evolution

Molecular Evolution

Molecular Evolution. Study of how genes and proteins evolve and how are organisms related based on their DNA sequence Molecular evolution therefore is the determination and comparative study of DNA and deduced amino acid sequences.

By gyan
(134 views)

Suppl. Fig. S1

Suppl. Fig. S1

Suppl. Fig. S1.

By delu
(94 views)

CGACCCGACTGCCCCATCCTCGACGATCTCGCGGGCGCCGACAAGACAGACGGCAAGCCC

CGACCCGACTGCCCCATCCTCGACGATCTCGCGGGCGCCGACAAGACAGACGGCAAGCCC

CGACCCGACTGCCCCATCCTCGACGATCTCGCGGGCGCCGACAAGACAGACGGCAAGCCC R P D C P I L D D L A G A D K T D G K P GCGAGAACCCACTGA ACTGCAATATCAGCCGGCGCACAAATATCGTGCCGTTCAAA AGGAG A R T H * AAAACC ATGAGTGCAACCACCTTCCACATCCCTGATATGACCTGCGGCCATTGCGAAAAG

By kimo
(37 views)

Position on the deduced amino-acid sequences

Position on the deduced amino-acid sequences

HIV. EIAV. V1. V2. V3. V4. V5. V6. V7. V8. State 2. State 2. State 1. State 1. V1/V2. V3. V4. V5. 0. 100. 200. 300. 400. SIV. SRLV. 0. 100. 200. 300. 400. 500. State 2. State 2. V1. V2. V3. V4. V5. State 1. State 1. V1. V2. V3. V4. V5. 0. 100. 200.

By naasir
(126 views)

Electronic Supplementary Material

Electronic Supplementary Material

Electronic Supplementary Material Hormone-sensitive lipase in Japanese flounder Paralichthys olivaceus : the potential function of the inclinator muscle of fin as a lipid storage site Anurak Khieokhajonkhet · Gen Kaneko · Kazuyuki Ohara · Hirohito Shirakami · Hideki Ushio

By thuong
(115 views)


View Deduced amino acid sequences PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Deduced amino acid sequences PowerPoint presentations. You can view or download Deduced amino acid sequences presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for Deduced amino acid sequences
Position on the deduced amino-acid sequences

Position on the deduced amino-acid sequences

HIV. EIAV. V1. V2. V3. V4. V5. V6. V7. V8. State 2. State 2. State 1. State 1. V1/V2. V3. V4. V5. 0. 100. 200. 300. 400. SIV. SRLV. 0. 100. 200. 300. 400. 500. State 2. State 2. V1. V2. V3. V4. V5. State 1. State 1. V1. V2. V3. V4. V5. 0. 100. 200.

By naasir (123 views)

Phylogenetic Trees From Amino Acid Sequences

Phylogenetic Trees From Amino Acid Sequences

Phylogenetic Trees From Amino Acid Sequences. Phylogenetic Trees. Show common ancestors Similar to a cladogram Horizontal distance between two species relates to the similarity between the two species, based on the measured character

By adena-cantrell (158 views)

Position on the deduced amino-acid sequence of EIAV SU

Position on the deduced amino-acid sequence of EIAV SU

State 8. State 2. State 7. State 6. State 5. State 4. State 1. State 3. State 2. V1. V2. V3. V4. V5. V6. V7. V8. State 1. State 0. 0. 100. 200. 300. 400. State 8. State 7. State 6. State 5. State 4. State 3. State 2. State 1. State 0. V1. V2. V3. V4. V5. V6.

By neil-mercer (197 views)

Amino Acid Sequences in V3 Loop Conformation

Amino Acid Sequences in V3 Loop Conformation

Amino Acid Sequences in V3 Loop Conformation . Alex Cardenas, Bobby Arnold and Zeb Russo Loyola Marymount University Department of Biology BIO 398 11/02/11. Outline . CD4 T cell count is a trait in developing AIDs ( >200 safe, <200 AIDs).

By all (0 views)

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES.

By idra (253 views)

Scoring the Alignment of Amino Acid Sequences

Scoring the Alignment of Amino Acid Sequences

Scoring the Alignment of Amino Acid Sequences. Constructing PAM and Blosum Matrices. Quotes from page 11 of our Lab Manual:. Proteins are huge molecules made up of large numbers of amino acids. The proteins are usually 100 to 500 amino acids long

By ashby (190 views)

Amino Acid Sequences in V3 Loop Conformation

Amino Acid Sequences in V3 Loop Conformation

Amino Acid Sequences in V3 Loop Conformation . Alex Cardenas, Bobby Arnold and Zeb Russo Loyola Marymount University Department of Biology BIO 398 11/02/11. Outline . CD4 T cell count is a trait in developing AIDs ( >200 safe, <200 AIDs).

By buffy-fletcher (147 views)

Analyzing Amino Acid Sequences to Determine Evolutionary Relationships

Analyzing Amino Acid Sequences to Determine Evolutionary Relationships

Molecular Evidence. Analyzing Amino Acid Sequences to Determine Evolutionary Relationships. Zach, Sally, and Sarah. Learning Target. 1. Students will know examples of scientific evidence that support the theory of evolution. Evolution. All organisms - common ancestor

By lilike (215 views)