100+ Database dna protein PowerPoint (PPT) Presentations, Database dna protein PPTs

Database dna protein - PowerPoint PPT Presentation

Database Similarity Search

Database Similarity Search. Why do we care to align sequences?. Sequences that are similar probably have the same function. new sequence. ?. Similar function. ?. Discover Function of a new sequence. Sequence Database. Discover Function of a new sequence.

★ ★ ★ ★ ★

401 views • 37 slides

From Pairwise Alignment to Database Similarity Search

From Pairwise Alignment to Database Similarity Search. Global vs Local Alignment. Global Alignment. ATTGCAGTG-TCGAGCGTCAGGCT ATTGCGTCGATCGCAC-GCACGCT. Local Alignment. CATATTGCAGTGGTCCCGCGTCAGGCT TAAATTGCGT-GGTCGCACTGCACGCT. Global vs. Local alignment.

★ ★ ★ ★ ★

559 views • 36 slides

View Database dna protein PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Database dna protein PowerPoint presentations. You can view or download Database dna protein presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Database dna protein' presentation slideshows

Database dna protein - PowerPoint PPT Presentation

Database Similarity Search

From Pairwise Alignment to Database Similarity Search