100+ Chuong huynh nih nlm PowerPoint (PPT) Presentations, Chuong huynh nih nlm PPTs

Chuong huynh nih nlm - PowerPoint PPT Presentation

Gene Prediction and Annotation techniques Basics

Gene Prediction and Annotation techniques Basics. Chuong Huynh NIH/NLM/NCBI Sept 30, 2004 huynh@ncbi.nlm.nih.gov. Acknowledgement: Daniel Lawson, Neil Hall. GATCGGTCGAGCGTAAGCTAGCTAG ATCGATGATCGATCGGCCATATATC ACTAGAGCTAGAATCGATAATCGAT CGATATAGCTATAGCTATAGCCTAT. What is gene prediction?.

★ ★ ★ ★ ★

1.16k views • 49 slides

View Chuong huynh nih nlm PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Chuong huynh nih nlm PowerPoint presentations. You can view or download Chuong huynh nih nlm presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Chuong huynh nih nlm' presentation slideshows

Chuong huynh nih nlm - PowerPoint PPT Presentation

Gene Prediction and Annotation techniques Basics