'Candidate genes' presentation slideshows

VYTP Virginia Youth Tobacco Project

905 views • 73 slides

Monitoring genetic change in natural populations

Monitoring genetic change in natural populations. Michael S. Schwartz U.S. Forest Service Fred W. Allendorf University of Montana. First Working Group jointly funded by NCEAS & NESCent. Initial meeting in March 2008. Objectives of Working Group

1.03k views • 58 slides

Talk Outline

Genomics of Natural Variation in Arabidopsis thaliana Justin Borevitz Salk Institute naturalvariation.org. Talk Outline. Natural Variation in Light Response PHYTOCHROME A/QTL mapping Fine Mapping/ Gene Expression candidates Single Feature Polymorphisms Deletion/ Candidate genes

572 views • 47 slides

Genetic resistance to infectious diseases in sheep and goats

1.03k views • 41 slides

Genetics of Depression: Psychotic forms of Unipolar and Bipolar Disorder

Genetics of Depression: Psychotic forms of Unipolar and Bipolar Disorder. J. Raymond DePaulo, Jr., M.D. Henry Phipps Professor and Director Department of Psychiatry and Behavioral Sciences Johns Hopkins University School of Medicine.

663 views • 40 slides

Schizophrenia

Schizophrenia. Chapter 10. Psychopathology. Sooner or later, half the population suffers a serious run-in Reactive or endogenous Very expensive Historically, known to run in families. Schizophrenia. Lifetime risk ~1% Long-term thought disorder Cognitive, emotional, motivational

519 views • 40 slides

Towards an understanding of Genotype-Phenotype correlations

Towards an understanding of Genotype-Phenotype correlations. Paul Fisher et al.,. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations. ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT.

538 views • 37 slides

Brainstorming Workshop on Sustainable Food Security through Technological Interventions for Production, Processing a

Brainstorming Workshop on Sustainable Food Security through Technological Interventions for Production, Processing and Logistics 5 th October , 2013 Gargi Hall, IIT Kharagpur. Sustainable Food Security through Technological Interventions for Production, Processing and Logistics

436 views • 36 slides

Applications of genome sequencing projects

500 views • 32 slides

Kartagener Syndrome: a relentless triad

Kartagener Syndrome: a relentless triad. Betsy Ott. 4 cases Quantified the clinical triad: Bronchiectasis Chronic sinusitis Situs inversus. Primary ciliary dyskinesia (PCD), formerly immotile cilia syndrome (ICS) PCD patients do not have situs inversus. 1933 Dr. Kartagener. Overview.

589 views • 31 slides

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations. Paul Fisher Dr. Robert Stevens Prof. Andrew Brass. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations.

464 views • 30 slides

Array CGH for constitutional disorders: from diagnosis to disease gene discovery

Array CGH for constitutional disorders: from diagnosis to disease gene discovery. Computational Systems Biology. CGH microarrays Molecular karyotyping. Location of chromosomal imbalances. Statistical analysis. Databasing. Validation. Prioritized candidate genes.

595 views • 29 slides

Osteoporosis

Osteoporosis. Excessive skeletal fragility leading to low trauma fractures. Intrinsic skeletal factors: low bone mass, unfavorable geometry at cortical bone sites, small bone size, poor bone structure at cancellous bone sites and sluggish or ineffective repair of microdamage.

1.11k views • 27 slides

Translational genomics research space

396 views • 24 slides

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations. Paul Fisher Dr. Robert Stevens Prof. Andrew Brass. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations.

386 views • 24 slides

A B C D E F

Chromosome-level Mutation. A B C D E F. G H I J K L M. A B C D E F G. D E F G H I J K L M. I H G J K L M. A B C. inversion. translocation.

360 views • 20 slides

Bipolar Disorder an Overview

Bipolar Disorder an Overview. October 2011. Introduction to Harvest Healthcare. Experience. Education. Excellence.

276 views • 19 slides

OBEKON Consortium

317 views • 19 slides

Genome-Wide Association: Current Best Practices and Perspectives

Genome-Wide Association: Current Best Practices and Perspectives. National Human Genome Research Institute. U.S. Department of Health and Human Services National Institutes of Health National Human Genome Research Institute. National Institutes of Health.

279 views • 16 slides

164 views • 9 slides