'Biological pathways' presentation slideshows

Functional Interpretation of Large-scale Omics Data through Pathway and Network Analysis

Functional Interpretation of Large-scale Omics Data through Pathway and Network Analysis. Bio-Trac 40 (Protein Bioinformatics) October 9, 2008 Zhang-Zhi Hu, M.D. Research Associate Professor Protein Information Resource, Department of Biochemistry and Molecular & Cellular Biology

802 views • 58 slides

Where we are and where we are going From biology to data and back again

599 views • 51 slides

Cardiff Neurosciences Centre (CNC)

519 views • 38 slides

Towards an understanding of Genotype-Phenotype correlations

Towards an understanding of Genotype-Phenotype correlations. Paul Fisher et al.,. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations. ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT.

540 views • 37 slides

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations. Paul Fisher Dr. Robert Stevens Prof. Andrew Brass. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations.

468 views • 30 slides

Roadmapping as a Planning Tool to Assess Strategies in a Rapidly Changing Market

Roadmapping as a Planning Tool to Assess Strategies in a Rapidly Changing Market Bob McCarthy, Ph.D. Director, Strategic Market Planning Roche Molecular Biochemicals Phone: 317-576-7475, Fax: 317-576-7317 e mail: robert-c.mccarthy@roche.com.

371 views • 27 slides

PMBC

PMBC. October 10, 2006 Drs. Matthews and Scheier. ?. Disease (Body). Psychosocial Factors (Mind). Psychological. Pathways. Chronic Burdens. and. Resource Bank:. Biological. Demographics. Pathways:. Social/environmental. Disability. Personal attributes. &. Disease.

428 views • 26 slides

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations. Paul Fisher Dr. Robert Stevens Prof. Andrew Brass. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations.

388 views • 24 slides

Bioinformatics Laboratory (AMC) Medical bioinformatics & e-Bioscience Antoine van Kampen

Bioinformatics Laboratory (AMC) Medical bioinformatics & e-Bioscience Antoine van Kampen. Scope: Research, Education, AMC Support Focus areas: Systems Genomics (biological pathways), e-Science Microarrays, Next Generation Sequencing, Metabolomics (LC-MS), Immunology

194 views • 1 slides