'2000 bp' presentation slideshows

2000 bp - PowerPoint PPT Presentation


Wx-7Am-5utr-F1a /Wx-7A-intr2-R1b

Wx-7Am-5utr-F1a /Wx-7A-intr2-R1b

N4AT4D. N7AT7D. N7DT7B. CS. N4AT4D. N4AT4D. N7AT7D. N7DT7B. N7AT7D. N7DT7B. CS. CS. M. M. M. 2000 bp. 1420 bp. 1320 bp. 1650 bp. 1150 bp. 1000 bp. 850 bp. 650 bp. 500 bp. Wx-7Am-5utr-F1a /Wx-7A-intr2-R1b. Wx-5utr-F1c /Wx-4A-intr1-R1a. Wx-5utr-F2b /Wx-7D-intr1-R1a. A.

By solomon-guerrero
(61 views)

CAPS Cleaved Amplified Polymorphic Sequence

CAPS Cleaved Amplified Polymorphic Sequence

CAPS Cleaved Amplified Polymorphic Sequence. CAPS. - CAPS (cleaved amplified polymorphic sequence) is also known as PCR-RFLPs (polymerase chain reaction-restriction fragment length polymorphisms). it was developed after the emerge of PCR technique.

By plato-larsen
(388 views)

Gel Electrophoresis

Gel Electrophoresis

Gel Electrophoresis. Method for separating molecules (DNA, proteins, etc.) on the basis of physical or chemical properties such as: (1) size (2) shape (3) electrical charge. Gel electrophoresis. A method of separating DNA in a gelatin-like material using an electrical field

By charles-donovan
(94 views)

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp. 2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp.

By chester-ashley
(110 views)

12,000 Years of American Indian History

12,000 Years of American Indian History

12,000 Years of American Indian History. The Blast IU 17 Fellowship Pennsylvania Intermediate Unit 17 Fall 2010 Colloquium. Catch my Campaign. Dr. Yohuru Williams & Anthony Fitzpatrick. Pennsylvania Common Core Standards. 8.2.4.C.5. Physical and human geography

By riggsj
(0 views)


View 2000 bp PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of 2000 bp PowerPoint presentations. You can view or download 2000 bp presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

Related Searches for 2000 bp
2000 bp 

2000 bp 

By damara (73 views)

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp. 2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp.

By chester-ashley (108 views)

BP Amoco Finland Executive summary June 21, 2000

BP Amoco Finland Executive summary June 21, 2000

BP Amoco Finland Executive summary June 21, 2000. Lauri Eskola Daniel Messmann Essi Keltomäki Jani Ojala Petteri Urmas. Agenda. Overview Organizational structure Job description, job specification Recruitment and selection Training Appraisal and compensation.

By demetria-richmond (73 views)

-198 bp - -175 bp - - 23 bp -

-198 bp - -175 bp - - 23 bp -

Cell line DNA conc. A260/A280 HGF-1 [884 ng/ m L] 1.90 SCC25 [895 ng/ m L] 1.87 SCC15 [850 ng/ m L] 1.76 CAL27 [821 ng/ m L] 1.92. MTHFR C677T Genotype. B. -198 bp - -175 bp - - 23 bp -. HGF-1 SCC25 SCC15 CAL27. 1: HGF-1 2: SCC25

By nicki (86 views)

BP Educational Resources bp

BP Educational Resources bp

BP Educational Resources www.bp.com. BP Website - Site Map. About BP. More About Us; United States. BP & Education. Where We Operate. Educational Resources. Fabric of America. BP Worldwide. A+ for Energy. Education. North America; U.S. BP Education Landing Page.

By nigel (144 views)

BP

BP

BP. És la unitat de temps que s’utilitza en les datacions geològiques per tal d’establir un ordre en el temps transcorregut en aquest planeta. BP, són unes sigles en llengua anglosaxona; ”before” “present”, és a dir “abans del present”.

By wattan (107 views)

BP Azerbaijan

BP Azerbaijan

BP Azerbaijan. 2010 Graduate and Intern Recruitment Program. Career in BP. When the people we hire today shape the business we are tomorrow. Challenge program.

By liam (308 views)

50 bp

50 bp

100%. 100%. 0%. 0%. 0%. 0%. 40. 10. 20. 30. 100%. 100%. 50 bp. A. Transposase based dendrogram. B. IS DNA extremities. C. DR lengths. Subgroups. CATGCCCATCAA+TTAAGAATTTAGACTACCCCCAAAAATAAAAAAACGT CATGCCCATCAACTTAAGGAAAAAAATAAAAAGAAATTA+GTTTATT+TG. IRL IRR. IS 231.

By micah (118 views)

Normalizacija BP

Normalizacija BP

Normalizacija BP. Pojam normalizacije. Normalizacija modela baze podataka je proces definisanja strukture baze podataka (entiteti, atributi i relacije) u optimalni format. Cilj normali zacije je otklanjanje redudantnosti. 1 normalna forma.

By yardley (114 views)

100 bp

100 bp

Supplementary Figure S3. Lane 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

By bell (86 views)