80 likes | 271 Views
Vicki & Joe. Bioinformatics DNA -> RNA-> Protein Codons 64 Different Codons Replication -> Transcription -> Translation Sequence Alignment. DNA: AGTCTCGTTACTTCTTCAAAT RNA: AGUCUCGUUACUUCUUCAAAU Codons: AGU CUC GUU ACU UCU UCA AAU Protein: SLVTFLN AGU - serine - S- ser
E N D
Vicki & Joe
Bioinformatics • DNA -> RNA-> Protein • Codons • 64 Different Codons • Replication -> Transcription -> Translation • Sequence Alignment
DNA: AGTCTCGTTACTTCTTCAAAT • RNA: AGUCUCGUUACUUCUUCAAAU • Codons: AGU CUC GUU ACU UCU UCA AAU • Protein: SLVTFLN AGU - serine - S- ser CUG - leucine - L - leu GUU - valine - V - val ACU - threonine - T - thr UCU - phenylalanine - F - phe UCA - leucine - L - leu AAU - asparagine - N - asn
Simple comparison between sequences • Matches • Mutations • Different Letters In Both Rows • Insertion • Space In Top Row • Deletion • Space In Bottom Row
Input: DNA Sequence • “1921 attttataga aaaatctctt” • Cleans The String • attttatagaaaaatctctt • Searches: • TTA, CTA, or TCA (Start Codons) • CAT (End Codon) • Checks Size (Pseudogene, Potential Gene) • Output: • Potenial Gene String
DNA-RNA-Protein • Nobelprize.org • Genetic Home Reference • ghr.nlm.nih.gov • A Science Primer • ncbi.nlm.nih.gov • Computer science and bioinformatics • Communications of the ACM • Volume 48 , Issue 3 (March 2005)
Quiz 1. How many chemical bases are in a codon? 2. What is one starting codon and the end codon? 3. How Many Different Codons are there? 4. How many amino acids are there?