molecular marker technologies l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
MOLECULAR MARKER TECHNOLOGIES PowerPoint Presentation
Download Presentation
MOLECULAR MARKER TECHNOLOGIES

Loading in 2 Seconds...

play fullscreen
1 / 84

MOLECULAR MARKER TECHNOLOGIES - PowerPoint PPT Presentation


  • 536 Views
  • Uploaded on

MOLECULAR MARKER TECHNOLOGIES. Training Workshop on Forest Biodiversity 5-16 June 2006. Lee Soon Leong Forest Research Institute Malaysia. Outlines. Organization and flow of genetic information Molecular techniques to reveal genetic variation Type of molecular markers

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MOLECULAR MARKER TECHNOLOGIES' - salena


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
molecular marker technologies

MOLECULAR MARKER TECHNOLOGIES

Training Workshop on Forest Biodiversity

5-16 June 2006

Lee Soon Leong

Forest Research Institute Malaysia

slide2

Outlines

  • Organization and flow of genetic information
  • Molecular techniques to reveal genetic variation
  • Type of molecular markers
  • Which marker for what purpose
  • Microsatellite marker
  • Case study 1: using microsatellites to estimate gene flow via pollen
  • Case study 2: using microsatellites for individual-specific DNA fingerprints
slide4

Deoxyribonucleic Acid (DNA): The molecule that encodes genetic information

A pairs with T

C pairs with G

DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder

slide5

Nuclear DNA:Diploid; biparental inherited; recombination occur; can be viewed as a huge ocean of largely nongenic DNA, with some tens of thousands of genes and gene clusters scattered around like small islands and archipelagos. A high proportion of this apparently nonfunctional DNA consists of repeated motifs and may be considered as junk DNA or selfish DNA

Choroplast DNA:Haploid; usually maternally inherited in angiosperms and paternally inherited in gymnosperms; typically ranging from 135 to 160 kb in size, is packed with genes and thus resembles the streamlined configuration of its cyanobacterial ancestral genome

Mitochondrial DNA:Haploid; typically maternally inherited; about 370 to 490 kb, about 10% of these sequences represent genes, another 10 to 26% were found to be made up of repetitive DNA, including retrotransposons. Thus, the majority of plant mtDNA sequences lack any obvious features of information

slide6

The rates of mutation are depending on:

  • Biology of organism
  • Genomes under consideration
  • Types of mutations
  • Organism’s genomic DNAs are subjected to mutation as a result of normal cellular operations or interactions with environment
slide7

Base substitution

Deletion

GATCCGAGTATCGCAATTAGCA

GATCCGAGTGTCGCAATTAGCA

GATCCGAGTATCGCAATTAGCA

GATCCGAGTAATTAGCA

Insertion

GATCCGAGTATCGCAATTAGCA

GATCCGAGTATCGCAGCATTAGCA

Duplication

Inversion

GATCCGAGTATCGCAATTAGCA

GATCCGAGTATCTCGCAATTAGCA

GATCCGAGTATCGCAATTAGCA

GATGCCAGTATCGCAATTAGCA

  • Mutations in genomic DNA can be classified into several categories:
slide8

Through long evolutionary accumulation, many different instances of mutation as mentioned above should exist in any given species

The number and degree of the various types of mutations define the genetic diversity within a species

It has been widely recognized that loss of genetic diversity is a major threat for the maintenance and adaptive potential of species

slide9

Example - if low genetic diversity, when a virulent form of a disease arises, many individuals may be susceptible and die

  • But as a result of natural genetic diversity within local plant populations, there may be some individuals that are at least partially resistant and there are able to survive and thus perpetuate the species

S

S

S

S

S

S

S

S

S

S

Low Genetic diversity

High Genetic diversity

S

S

S

S

S

S

S

S

S

S

R

S

S

S

R

S

S

R

S

S

R

S

S

S

R

S

S

R

S

S

All die

Partially resistant

slide10

For many plant species, ex situ and in situ conservation strategies have been developed to safeguard the extant of genetic diversity

  • To manage this genetic diversity effectively the ability to identify genetic diversity is indispensable
  • In addition, for this variation to be useful, it must beheritableanddiscernable;as recognizable phenotypic variation or as genetic mutation distinguishable throughmolecular marker technologies
slide11

Mutation

Mutation arises genetic variation at the DNA level

DNA markers

Subsequently, mutation arises genetic variation at DNA will cause variation at the protein level

Protein markers

Definition of molecular markers

A sequence of DNA or protein that can be screened to reveal key attributes of its state or composition and thus used to reveal genetic variation

slide12

Four major molecular techniques are commonly applied to reveal genetic variation. These are:

  • Polymerase chain reaction(PCR)
  • Electrophoresis
  • Hybridization
  • DNA sequencing
slide13

PCR is a procedure used to amplify (make multiple copies of) a specific sequence of DNA

POLYMERASE CHAIN REACTION

The method was invented by Kary Banks Mullis in 1983, for which he received the Nobel Prize in Chemistry ten years later

three temperature-controlled steps

slide14

The term 'electrophoresis' literally means "to carry with electricity"

ELECTROPHORESIS

Technique for separating the components of a mixture of charged molecules (proteins, DNAs, or RNAs) in an electric field within a gel or other support

Migration rate depend on electrical charge and size

slide15

HYBRIDIZATION

One of the most commonly used nucleic acid hybridization techniques is Southern blot hybridization

Southern blotting was named after Edward M. Southern who developed this procedure at Edinburgh University in the 1975

slide16

The process of determining the order of the nucleotide bases along a DNA strand is called sequencing

Principle: single-stranded DNA molecules that differ in length by just a single nucleotide can be separated from one another using PAGE

Chain elongation proceeds until, by chance, DNA polymerase inserts a dideoxynucleotide, blocking further elongation

SEQUENCING

In 1977, 24 years after the discovery of the structure of DNA, two separate methods for sequencing DNA were developed: chain termination method and chemical degradation method

slide17

Recent detection techniques

TaqMan – a probe used to detect specific sequences in PCR products by employing 5’ to 3’ exonuclease activity of the Taq DNA polymerase

Pyrosequencing – refers to sequencing by synthesis, a simple to use technique for accurate analysis of DNA sequences

Microarray Technology – a high throughput screening technique based on the hybridization between oligonucleotide probes (genomic DNA or cDNA) and either DNA or mRNA

slide18

Biochemical marker

Allozyme

Traditional marker systems

Non-PCR based marker

RFLP, Minisatellite (VNTR)

PCR based marker

PCR generation: in vitro DNA amplification

Microsatellite, RAPD, AFLP, CAPS (PCR-RFLP), ISSR, SSCP, SCAR, SNP, etc.

TYPES OF MOLECULAR MARKERS

  • Due to rapid developments in the field of molecular genetics, a variety of molecular markers has emerged during the last few decades
slide19

Allozyme (biochemical marker)

  • The alternative forms of a particular protein visualized on a gel as bands of different mobility. Polymorphism due to mutation an amino acid has been replaced, the net electric charge of the protein may have been altered

Technique: Electrophoresis and enzyme staining

slide20

RFLP (Non-PCR based marker)

  • Targets variation in DNA restriction sites and in DNA restriction fragments. Sequence variation affecting the occurrence (absence or presence) of endonuclease recognition sites is considered to be main cause of length polymorphisms

Techniques: Electrophoresis and hybridization

slide21

RAPD (PCR-based marker)

Uses primers of random sequence to amplify DNA fragments by PCR. Polymorphisms are considered to be primarily due to variation in the primer annealing sites, but they can also be generated by length differences in the amplified sequence between primer annealing sites

Techniques: PCR and Electrophoresis

slide22

AFLP (PCR-based marker)

  • A variant of RAPD. Following restriction enzyme digestion of DNA, a subset of DNA fragments is selected for PCR amplification and visualization

Techniques: PCR and Electrophoresis

slide23

Microsatellite (PCR based marker)

  • Targets tandem repeats of a small (1-6 base pairs) nucleotide repeat motif. Polymorphism due to the number of tandem repeats

Techniques: PCR and Electrophoresis

slide24

Other markers

  • Cleaved Amplified Polymorphic Sequence (CAPS/PCR-RFLP)
  • Inter Simple Sequence Repeat (ISSR)
  • Single-strand conformation Polymorphism (SSCP)
  • Sequence Characterized Amplified Region (SCAR)
  • More recent markers
  • Single-Nucleotide Polymorphism (SNP)
  • Retrotransposon-based markers
    • Sequence-Specific Amplified Polymorphism (S-SAP)
    • Inter-retrotransposon Amplified Polymorphism (IRAP)
    • Retrotransposon-Microsatellite Amplified Polymorphism (REMAP)
    • Retrotransposon-Based Insertional Polymorphism (RBIP)
slide25

Weising, K., Nybom, H., Wolff, K. and Kahl, G. 2005. DNA Fingerprinting in Plants, Priciples, Methos, and Applications. 2nd Edition. CRC Press, Boca Raton, Florida, USA.

Spooner, D., van Treuren, R. and de Vicente, M.C. 2005. Molecular markers for genebank management. IPGRI Technical Bulletin No. 10. International Plant Genetic Resources Institute, Rome, Italy.

Henry, R.J. 2001. Plant Genotyping: The DNA Fingerprinting of Plants. CAB International Publishing, Wallingford, U.K.

slide26

Markers differ with respect to important features:

  • Genomic abundance
  • Polymorphism level
  • Locus specificity
  • Reproducibility
  • Technical requirements
  • Financial investment
slide27

Codominance or dominace

Dominant marker:

A marker shows dominant inheritance with homozygous dominant individuals indistinguishable from heterozygous individuals

Codominant marker:

A marker in which both alleles are expressed, thus heterozygous individuals can be distinguished from either homozygous state

slide28

Intraspecific (among individuals) – markers target less conserve region

Interspecific (among species) – markers target more conserve region

None of the available techniques is superior to all others for a wide range of applications, but the key-question rather is which marker to use in which situation

  • Within and among population variation – Allozyme, SSR, AFLP and RAPD
  • Mating system study – Allozyme or microsatellite
  • Estimating gene flow via pollen and seed – Microsatellite (SSR)
  • Phylogeography – cpSSR
  • Clonal identification – AFLP or RAPD
  • Polyploidy – multilocus dominant marker (AFLP)
  • Genetic Linkage Mapping – AFLP, RAPD, Allozyme, RFLP, SSR, CAPS, SNP
  • Phlogenetic study – conserve within species (DNA sequencing)

.

slide29

A framework for selecting appropriate techniques for plant genetic resources conservation can be referred to:

Karp, A., Kresovich, B., Bhat, K.V., Ayad, W.G. and Hodgkin, T. 1997. Molecular Tools in Plant Genetic Resources Conservation: A Guide to the Technologies. IPGRI Technical Bulletin No. 2. International Plant Genetic Resources Institute, Rome, Italy

slide30

Microsatellite marker

  • What are microsatellite?
  • Where are microsatellites found?
  • How do microsatellites mutate?
  • Abundance in genome
  • Why do microsatellite exist?
  • Models of mutation
  • Development of microsatellite primers
  • Genotyping procedure
  • Advantages
  • Disadvantages
  • Applications
slide31

What are microsatellite?

  • Tandem repeated sequences with a 1-6 repeat motif
    • Dinucleotide (CT)6 - CTCTCTCTCTCT
    • Trinucleotide (CTG)4 - CTGCTGCTGCTG
    • Tetranucleotide (ACTC)4 - ACTCACTCACTCACTC
  • Synonymous to SSR and STR; Depending on nature of repeat tract, SSR can further divided into four categories:
slide32

Where are microsatellites found?

Majority are in non-coding region

slide33

DNA polymerase slippage

Unequal crossing over

How do microsatellites mutate?

  • Microsatellites alleles change rather quickly over time
    • E. coli – 10-2 events per locus per replication
    • Drosophila – 6 X 10-6 events per locus per generation
    • Human – 10-3 events per locus per generation
slide34

Microsatellites have been found in every organism studied so far

  • Most frequent in human > insect > plant > yeast > nematode
  • Most common dinucleotide:
  • Human

CA/GT

  • Conifer

GA/CT & CA/GT

  • Dipterocarp

GA/CT

Abundance in genome

slide35

Why do microsatellite exist?

  • Majority are found in non-coding regions; thought no selective pressure; as "junk" DNA?
  • Regulate gene expression and protein function, e.g., human diseases caused by expansions of polymorphic trinucleotide repeats in genes fragile X and myotonic dystrophy
  • In plant, high density of SSRs were found in close proximity to coding regions; regulatory properties
  • High level of polymorphism; a necessary source of genetic variation
slide36

The mutation model still unclear but stepwise mutation appears to be the dominant force creating new alleles in the few model organisms studied to date

  • Stepwise Mutation Model (SMM) - when SSRs mutate, they gain or lose only one repeat
  • Two alleles differ by one repeat are more closely related than alleles differ by many repeats

Models of Mutation

  • Several statistics based on estimates of allele frequencies (e.g., Fst & Rst) rely explicitly on a mutation model
  • Size matters when doing statistical tests of population substructuring
slide37

Development of microsatellite primers

  • Can be time consuming and expensive. May be obtained by screening sequence in databases or screening libraries of clones
  • Standard method to isolate microsatellites from clones
    • Creation of a small insert genomic library
    • Library screening by hybridization
    • DNA sequencing of positive clones
    • Primer design and PCR analysis
    • Identification of polymorphisms
  • This approach can be extremely tedious and inefficient for species with low microsatellite frequencies
slide38

Alternative strategies to overcome

    • Selective hybridization using nylon membrane
    • Selective hybridization using steptavidin coated beads
    • RAPD based
    • Primer extension
slide39

Electrophoresis

Agarose

PAGE

Denaturing PAGE

Capillary

Visualization

Silver staining

SybrGreen staining

Autoradio-graphy

Fluorescent dyes

Genotyping procedure

PCR

slide40

Locus 1

Locus 2

Primer1

Primer4

Primer2

Primer3

Locus 3

Locus 4

  • The use of fluorescently labeled primers, combine with automated electrophoresis system greatly simplified the analysis of microsatellite allele sizes
slide41

Numberous bands differ in size by 2 bp caused by slippage of DNA polymerase

Non-templated addition of an extra A to 3’ end of PCR products

Stutter

Extra A

120/120

122/122

120/122

120/124

120/126

120/128

slide43

Advantages

  • Low quantities of template DNA required (10-100 ng)
  • High genomic abundance
  • Random distribution throughout the genome
  • High level of polymorphism
  • Band profiles can be interpreted in terms of loci and alleles
  • Codominance of alleles
  • Allele sizes can be determined with an accuracy of 1 bp, allowing accurate comparison across different gels
  • High reproducibility
  • Different SSRs may be multiplexed in PCR or on gel
  • Wide range of applications
  • Amenable to automation
slide44

Disadvantages

  • High development costs in case primers are not yet available. Primers might be species specific
  • Heterozygotes may be misclassified as homozygotes when null-alleles occur due to mutation in the primer annealing sites
  • Stutter bands on gels may complicate accurate scoring of polymorphisms
  • Underlying mutation model (infinite alleles model or stepwise mutation model) largely unknown
  • Homoplasy due to different forward and backward mutations may underestimate genetic divergence
slide45

Applications

Generally, high mutation rate makes them informative and suitable for intraspecific studies but unsuitable for studies involving higher taxonomic levels

  • Population genetics: investigations within a genus of centers of origin, genetic diversity, population structures and relationships among species
  • Parentage analysis: seed orchard monitoring, mating systems and gene flow via pollen & seed
  • Fingerprinting: clone confirmation and individual-specific fingerprints
  • Genome mapping - Constructing full coverage or QTL maps
  • Comparative mapping - Genome structure, framework maps, or transferring trait and marker data among species
slide47

Pollen flow distance?

  • Outcrossing rate?
  • Effective breeding unit?
slide48

Shorea parvifolia

Shorea leprosula

slide49

Sample collection

DNA extraction

SSRs analysis

SSRs development

Data analysis

  • Gene flow: exclusion and likelihood approaches
  • Effective breeding unit: Nason et al. (1998)
  • Model of pollen dispersal to get maximum pollen flow distance

Methodology

slide50

Microsatellite Loci

Lee, S.L. et al. 2004. Isolation and characterization of 21 microsatellite loci in an important tropical tree Shorea leprosula and their applicability to S. parvifolia. Molecular Ecology Notes 4: 222-225

slide52

Pasoh Forest Reserve - 50-ha plot (190 individuals of S. leprosula and 102 of S. parvifolia 27 cm dbh within the 50-ha plot)

slide56
Shorea leprosula – 9 loci (Pe = 0.999)
    • lep074a, lep384, lep111a, lep118, lep280, lep267, lep294, lep475 & lep562
    • PCR (500 x 9 = 4500 reactions)
  • Shorea parvifoila – 6 loci (Pe = 0.999)
    • lep074a, lep384, lep111a, lep118, lep280 & lep294
    • PCR (360 x 6 = 2160 reactions)
conclusion
Conclusion
  • Moderate pollen flow (150 – 300 m) – Thrips as pollinators
  • Predominant outcrossing (85%) & mix-mating (60%)
  • Model for pollen dispersal – negative exponential model
  • Optimum population size for conservation - breeding unit area & breeding unit size obtained (about 70 ha)
slide64

To track the illegal log into its original population

Required fingerprinting databases for population identification

To match the illegal log into its original stump

Required fingerprinting databases for individual identification

In forensic applications in forestry and chain of custody certification, two types of databases are required

slide65

Log being stolen / Illegal logging

Collect sample for DNA extraction

  • Perform DNA analysis using DNA markers
  • Comparison of DNA profiles of log & stump
  • If the same, they are from the same tree

Stump being left behind

Collect sample for DNA extraction

DNA markers to match the illegal log into its original stump

slide66

Random MATCH!!

  • However, In DNA testimony, it is necessary to provide an estimate of the weight of the evidence
  • Three possible outcomes of a DNA test: no match, inconclusive, or MATCH between samples examined
  • If MATCH, it would not be scientifically justifiable to speak of a match as poor proof of identity in the absence of underlying data that permit some reasonable estimate of how rare the matching characteristics actually are
  • Therefore, in forensic casework, a population database must be established for statistical evaluation of the evidence to extrapolate the possibility of a random match
slide68

Sample collection

DNA extraction

SSRs analysis

SSRs screening

Data analysis

Comprehensive DNA fingerprinting databases of N. heimii generated for individual identification throughout P. Malaysia

Methodology

slide69

KEDAH

Bkt. Enggang (BEn)

Sungkop (Sun)

PERAK

Piah (Pia)

Bubu (Bub)

Chikus (Chi)

SELANGOR

Sg Lalang (SLa)

Ampang (Amp)

Gombak (Gom)

N. SEMBILAN

Pasoh (Pas)

Pelangai (Pel)

JOHOR

Labis (Lab)

Panti C16 (PaA)

Panti C68 (PaB)

Lenggor C32 (LeA)

Lenggor C76 (LeB)

KELANTAN

Lebir (Leb)

Jeli (Jel)

G. Basor (GBa)

TERENGGANU

Rambai Daun (RDa)

H. Terengganu C31 (HTA)

H. Terengganu C14A (HTB)

Pasir Raja (PRa)

PAHANG

Lesong (Les)

Bkt. Tinggi (BTi)

Rotan Tunggal (RTu)

Tersang (Ter)

Lentang (Len)

Lakum (Lak)

Kemasul (Kem)

Berkelah (Ber)

BEn

Sun

Jel

GBa

Leb

Pia

HTB

HTA

Bub

PRa

RDa

Chi

Ter

RTu

Ber

Lak

BTi

Gom

Len

Kem

SLa

Amp

Pas

Pel

Les

Lab

LeB

LeA

PaA

PaB

Sample collection

slide70

SSRs screening

  • 51 SSR primer pairs developed for dipterocarps
    • Neobalanocarpus heimii (6) (Iwata et al. 2000)
    • Shorea lumutensis (2) (Lee et al. 2006)
    • Shorea leprosula (21) (Lee et al. 2004a)
    • Hopea bilitonensis (15) (Lee et al. 2004b)
    • Shorea curtisii (7) (Ujino et al. 1998)
slide72

Maternal genotype

Half-sib genotypes

Mode of inheritance

Qualitative observations (each progeny possessed at least one maternal allele) to support the postulation of single-locus mode of inheritance

slide73

Null allele

  • Homozygote excess (MICROCHECKER; Van Oosterhout et al. 2004)
  • Examine patterns of inheritance
  • If any Individuals repeatedly fail to amplify any alleles at just one locus while other loci amplify normally
slide74

Repeat motif

Dinucleotide repeats (CT)n to mononucleotide repeats (A)n

slide76

Null allele

Mode of inheritance

Repeat motif

51 SSR primer pairs

Size homoplasy

Specific amplification

16 SSR primer pairs selected

Nhe004, Nhe005, Nhe011, Nhe015, Nhe018, Nhe019, Hbi016, Hbi161, Sle111a, Sle392, Sle605, Slu044a, Shc03, Shc04, Shc07, Shc09

slide77

Clustering analysis on genetic distance via NJ method

Relatedness among individuals using ML-Relate software

  • Unrelated individual (86.4%)
  • Half-siblings (12.4%)
  • Full-siblings (0.9%)
  • Parent-offspring (0.3%)
  • What model to use: product rule or subpopulation models?

Pasoh Forest Reserve (231 individuals)

  • Perform statistical tests to check:
    • Hardy-Weinberg equilibrium for allele independence
    • Linkage equilibrium for locus independence
  • Results clearly showed that population is deviated from HWE

Population substructuring

Inbreeding

slide78

Ayres and Overall (1999). Forensic Science International 103: 207-216

  • Random match probability need to be calculated using subpopulation model and corrected for coancestry (FST) and inbreeding (FIS) coefficients
slide80

REGION B

Pas, Pel, Lab, PaA, PaB, LeA, LeB, Les, BTi, RTu, Ter, Len, Lak, Kem, Ber, RDa

REGION A

BEn, Sun, Bub, Chi, SLa, Amp, Gom

REGION C

HTA, HTB, PRa, Leb, Jel, GBa, Pia

Allele frequencies

Fst = 0.0470

Fis = 0.1758

Match probability

Allele frequencies

Fst = 0.0285

Fis = 0.1457

Match probability

Allele frequencies

Fst = 0.0334

Fis = 0.1998

Match probability

DNA fingerprinting databases of N. heimiii throughout P. Malaysia

  • Hardy-Weinberg equilibrium for allele independence
  • Linkage equilibrium for locus independence
slide83

DNA fingerprinting database Region A (Allele frequencies)

Sub-population model (Fst = 0.0470; Fis = 0.1758)

Using database to extrapolate the possibility of a random match

slide84

99.9999999…% sure that the log is originated from this stump

Provides legal evidence to convict the illegal loggers

To ensure conservation & sustainable utilization of FGRs