210 likes | 401 Views
Everything you wanted to know about DNA but were afraid to ask. DNA. A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive. DNA. Gives you your characterisitcs
E N D
Everything you wanted to know about DNA but were afraid to ask.
DNA • A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive.
DNA • Gives you your characterisitcs • Traits like eye color, height, & hair texture.
DNA’s Two jobs • Instruction manual that builds and maintains cells • Able to copy itself each time a cell divides
DNA DOUBLE HELIX-Twisted ladder or spiral staircase Sides of ladder are made of molecules of sugar called deoxyribose alternating with molecules of phosphate The rungs of the ladder are made of nitrogen bases: Adenine A Thymine T Guanine G Cytosine C
A little History Rosalind Franklin • She made the first image of an actual DNA molecule using x-ray diffraction • Through this breakthrough we learned that DNA has a spiral shape
Watson & Crick • 1953’s they built the first model of DNA • Won the Nobel Prize
Erwin Chargaff • 1950’s Chargaff found equal amounts between certain base pairs • Adenine=Thymine • Cytosine=Guanine • Called Chargaff’s Rules
Making copies of DNA • This occurs in interphase • Adenine always pairs w/ Thymine A~~~~~~~~ T • Cytosine always pairs w/ Guanine C~~~~~~~~G
How copies are made • DNA unwinds and separates (like a zipper) • Bases on the open strand are used as a pattern for the new strand • Nitrogen bases that are floating in the nucleus pair up with the bases on each half of the unzipped DNA • Half of DNA is old & half is new
How DNA works • About 2 meters of DNA in every cell of your body • It is wound, coiled and bundled to fit inside every cell • Order of the bases on one side is a CODE that carries information • Gene- is a piece of that code that gives the cell information on the trait it controls
Reading the Code • ATTGGCCTTGATCCCCCATAGCGATGTGTACACTC • The code is read like a book from one end to another • They are split up by 3’s • AGC is a code for a protein called “serine”
Mutations: the causes DNA damage from environmental agents such as ultraviolet light (sunshine), nuclear radiation or certain chemicals Mistakes that occur when a cell copies its DNA in preparation for cell division. Changes in the number, type, or order of bases on DNA
Types of Mutations Deletion- When a base is left out Insertion- When a base is added Substitution - Occurs when the wrong base is used
What can happen? • Improved trait • No change • Harmful trait such as sickle cell disease
Clones A new organism with an exact copy of DNA from another organism This is CopyCat: the first cat cloneResearchers in Texas have cloned a domestic cat, producing a two-month-old kitten called CopyCat.