saad
Uploaded by
16 SLIDES
321 VIEWS
160LIKES

DNA’s Function

DESCRIPTION

DNA’s Function. DNA. DNA = deoxyribonucleic acid. DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and materials the body needs to function. DNA is capable of self-replication.

1 / 16

Download Presentation

DNA’s Function

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA’s Function

  2. DNA • DNA = deoxyribonucleic acid. • DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and materials the body needs to function. • DNA is capable of self-replication. • Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria. Wellcome Images – Oliver Burston

  3. The structure of DNA • The shape of the molecule is described as a “double helix”. • The building blocks of DNA are nucleotides. • A nucleotide consists of one phosphate molecule, a five-sided sugar molecule (deoxyribose sugar), and one nitrogen base.

  4. DNA - the double helix Wellcome Images – Peter Artymiuk Wellcome Images – Oliver Burston

  5. The structure of the double helix Wellcome Images - Pete Jeffs

  6. The ladder model • The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder. • The side rails of the ladder (the “backbone”) are alternating phosphate and sugar molecules.The rungs are paired nitrogen base molecules held together by a hydrogen bond.

  7. The “ladder” model Backbone Base pair Nucleotide NIH - National Human Genome Research Institute

  8. The base pairing rule • Each “rung” of the DNA ladder is formed from two nitrogen bases. • There are four bases – adenine(A), thymine (T), cytosine(C), and guanine (G). • The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G).

  9. The base pairs The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds, whereas adenine and thymine are bound by 2 hydrogen bonds. NIH - National Human Genome Research Institute

  10. Location of DNA • Most of the DNA occurs in the cell nucleus; however, each mitochondrion contains 37 genes – this is referred to as mitochondrial DNA.

  11. The function of DNAGenes • A chromosome consists of segments of DNA known as genes. • Genes contain the instructions for the construction of a particular protein, or RNA. • It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3 billion base pairs).

  12. Introns and exons • Genes consist of introns and exons • Exons are sections of coding DNA – i.e. they contain instructions for making proteins. • Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they do not contain instructions for making proteins but are now believed to serve other important functions.

  13. The genetic code • The sequence of bases in a gene is a code instructing the cell how to construct a particular protein – i.e. the number of amino acids and the order in which they are to be assembled.

  14. Reading the code • The sequence of bases is read in groups of three called codons. • Thus the sequence: AAGCCGTTTAGAGAGATTCCT Is read as: AAG CCG TTT AGA GAG ATT CCT • Each codon represents one of the 20 different amino acids.

  15. How DNA works National Human Genome Research Institute - NIH

  16. Proteins are long chains of amino acids The sequence of bases in a gene is a code instructing the cell how to construct a particular protein – i.e. the number of amino acids and the order in which they are to be assembled.

More Related