slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
& SPECIAL TECHNIQUES PowerPoint Presentation
Download Presentation
& SPECIAL TECHNIQUES

Loading in 2 Seconds...

play fullscreen
1 / 12

& SPECIAL TECHNIQUES - PowerPoint PPT Presentation


  • 114 Views
  • Uploaded on

PCR APPLICATIONS. Dr Fiona Tanzer. & SPECIAL TECHNIQUES. Some applications:. Specific sequence targeting Fishing for unknown sequences (uncloned) Assembling artificial sequences Site-directed mutagenesis Adding enzyme sites, start and stop codons Detecting clones – colony PCR

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '& SPECIAL TECHNIQUES' - rhea-cook


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

PCR APPLICATIONS

Dr Fiona Tanzer

& SPECIAL TECHNIQUES

some applications
Some applications:
  • Specific sequence targeting
  • Fishing for unknown sequences (uncloned)
  • Assembling artificial sequences
  • Site-directed mutagenesis
  • Adding enzyme sites, start and stop codons
  • Detecting clones – colony PCR
  • Detecting mRNA – Reverse transcriptase PCR
  • Assaying copy number – real-time pcr
slide3

ASSEMBLING ARTIFICIAL SEQUENCE

40-base oligomers

DNA template assembly:

30 - 50 cycles PCR

1

5'

3'

3'

5'

add outside primers;

gene amplification: 25 cycles PCR

2

clone into sequencing vector

3

slide4

40-base oligomers

20 20 20

40

1

60

80

2

add outside primers; gene amplification

slide5

SITE-DIRECTED MUTAGENESIS

A

.… ACTTGCAAATTGGTCGATCG…3’

…..TGAACGTTTAACCAGCTAGG…5’

5’ – ACTTGCAAATTATCGATCG- 3’

T

A

SIGNAL OR RESTRICTION SITE ADDITION

Hind III start

5’ - NNAAGCTTNNATGACTTGCAAATTGG – 3’

…..… ACTTGCAAATTGGTCGATCG…

slide6

COLONY PCR

No need to extract DNA from bacteria

slide7

Reverse Transcription-PCR

(RT-PCR)

Amplified copies of specific mRNA

1. Extract total RNA

2. Reverse Transcription

3. PCR

dNTPs

primer

Double stranded “Copy DNA”

(PCR template)

Reverse Transcriptase

slide8

ASSAYING COPY NUMBER: REAL-TIME PCR

Agarose Gel

Traditional PCR detection

Area for Real-time PCR detection

10 copies

50 copies

Problems with traditional end-point detection:

Low sensitivity

Low resolution

Poor precision

slide10

SYBR Green Dye Assay

Binds to any double-stranded DNA

- Specific product

- Non-specific product

- Primer dimers