1 / 12

Fluorescent E. Coli at Low Temperatures Using Promoter Integration

This project aims to engineer E. coli to fluoresce red at low temperatures (37°C) in the presence of Cl or Cl(ts). The goal is to determine the optimal temperature (30-37°C) and concentration of Cl for fluorescence. The design utilizes a modified lambda Prm promoter and targets genes from coral. The project explores expressing high (green) and low (red) temperature genes in a single sequence while developing alternative strategies for expression via high-temperature components. A complete Biobricks sequence is utilized, offering a comprehensive approach to achieve the desired fluorescence.

rene
Download Presentation

Fluorescent E. Coli at Low Temperatures Using Promoter Integration

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. E. Coli Fluorescing Red at Cold Temperature Sensor Prm + I12007 . B0032 Team: E Cool I Tina Khoury Jeremy Gerbig Kerwin Dunham Derek Blanchard

  2. Goals • Achieve • E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts). • Find optimum temp where color change will be found. • ~ 30-37°C • Find optimum concentration of Cl. • Gene originally from coral. • Backup Plan • Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. • Expressing high (green) and low (red) temp. genes in one sequence.

  3. How to do it? • Part 1 • BBa_I12007 • 82Bp • Promoter: modified lambda Prm Promoter • (OR-3 obliterated) • 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3 • gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt

  4. Part 2 & 3 Super Part BBa_I13503 • Spring 2008 Distribution Source Plate 1002 1D pSB1A2 • BBa_B0032 • 13Bp • Ribosome Binding Site RSB.3 • (medium)- derivative of BBa_0030 • 2010 Kit Plate 1 Well 2I, pSB1A2 • tcacacaggaaag

  5. Part 2 & 3 Super Part BBa_I13503 • Spring 2008 Distribution Source Plate 1002 1D pSB1A2 • 3 BBa_E1010 • 681Bp • Gene: highly engineered mutant of red fluorescent protein from Discosoma striata (coral) • 2010 Kit Plate 1 Well 18F, pSB2K3 • atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa

  6. Part 4 & 5 Super Part BBa_B0015 • BBa_B0010 doubleT • 129 Bp • Stop, T1 from E. coli rrn B • (Transcriptional Terminator) • 2010 Kit Plate 1 Well 13D, pSB1A2 • BBa_B0012 • Stop, TE from coliophage T7 • (Transcriptional Terminator) • Source Plate 1000 Well 1B, pSB1A2 • ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

  7. What’s new? • The complete complex Biobricks sequence that works! • Combine 3 parts • BBa_I12007 - Promoter • BBa_I13503 - RBS + Gene • BBa_B0015 - Double Terminator Promoter RBS + Gene Double Terminator

  8. Alternate Part • May use double terminator because the first terminator has had problems working according to partsregistry.org • Possible double terminator is BBa_B0015 double terminator(B0010-B0012) 2010 Kit Plate 1 Well 23L, pSB1AK3. According to the website, this part works well.

  9. Protocol • Isolate biobricks out of wells. • BBa_I12007 - Promoter • BBa_I13503 - RBS + Gene • BBa_B0015 - Double Terminator • Transform the bacteria. • Grow the transformed bacteria. • Isolate & check plasmids. • Gel Electrophoresis

  10. Protocol cont… • Combining biobrick parts by digestion & ligation. • BBa_I12007 - Promoter • BBa_I13503 - RBS + Gene • BBa_B0015 - Double Terminator S X & P X & P

  11. Protocol cont…. • Transform bacteria with new recombinant plasmid. • Observe results • Color change dependent on • Temp between ~ 30-37°C • Cl concentration ~ 1x – 10x

  12. References • Openwetware.org • Partsregistry.org • http://filebox.vt.edu/.../biol_4684/Methods/genes.html • http://www.fasebj.org/content/vol20/issue14/images/large/z386120661480003.jpeg • http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=mga&part=A1549 • http://www.stat.berkeley.edu/users/terry/Classes/s260.1998/Week8b/week8b/node3.html

More Related