1 / 12

International Tomato Genome Sequencing Project

International Tomato Genome Sequencing Project. Country. USA. Korea. China. UK. India. NL. France. Japan. Spain. USA. USA. Italy. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Chromosome. Mb. 24. 26. 26. 19. 12. 20. 27. 17. 16. 10. 13. 11. T=220. To sequence.

rendor
Download Presentation

International Tomato Genome Sequencing Project

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. International Tomato Genome Sequencing Project Country USA Korea China UK India NL France Japan Spain USA USA Italy 1 2 3 4 5 6 7 8 9 10 11 12 Chromosome Mb 24 26 26 19 12 20 27 17 16 10 13 11 T=220 To sequence BACs 246 268 274 193 120 213 277 175 164 108 135 113 T=2285 0 µm 53.8 Mb 64.7 Mb 64.7 Mb 80.0 Mb 82.1 Mb 80.3 Mb 81.8 Mb 76.4 Mb 83.6 Mb 85.6 Mb 88.5 Mb Euchromatin 108.0 Mb Heterochromatin 70 µm

  2. Indian Initiative on Tomato Genome Sequencing Telomeric Region University of Delhi South Campus Euchromatic Region UDSC & NCPGR Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma (0-60 cM) Heterochromatic Region National Research Centre for Plant Biotechnology Centromeric Region Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad Heterochromatic Region NRCPB (69-119 cM) National Centre for Plant Genome Research Euchromatic Region Debasis Chattopadhyay Sabhyata Bhatia Telomeric Region

  3. Criteria for BAC selection and confirmation • Selection of two candidate seed BACs on chromosome 5 • specific marker • 100 kb or more in size • end sequence availability at SGN • 2. Purity check of bacterial stock • Hind III fingerprint of DNA isolated from six independent colonies • 3. PCR amplification of genetic markers/overlapping region • two marker/overlapping region-specific primer pairs • 4. BAC verification by direct sequencing • using two marker/overlapping region-specific primers • using vector-specific SP6 and T7 primers • 5. Size estimation/confirmation of BAC clone • by CHEF analysis of Not I digested BAC DNA • 6. Validation of BAC on chromosome 5 using Introgression Lines • polymorphism in PCR products • SNP detection of non-polymorphic bands

  4. Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker:CT101 Seed BAC:LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2:TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82) L. esculentum L. pennellii IL 5-1 IL 5-2 IL 5-3 IL 5-4 IL 5-5

  5. Confirmation of markers and their assigned seed BAC positions on chromosome 5

  6. Reallocation of marker T0876 and its associated BAC positions on chromosome 7

  7. The path for genomic sequencing Single streak of BAC clones from seed BAC library DNA extraction DNA fingerprinting (HindIII-digested) for BAC stock purity PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end-sequence database

  8. The selected seed BACs and extension BACs Status Clones selected Marker cM Telomeric Region Phase I SL_MboI0050C14 CT101 0 Phase III LE_HBa0191B01 LE_HBa0106O06 Phase II 0 C2-At1g60440 Phase II T1252 3 LE_HBa0051A13 Phase II SL_MboI0005B15 Euchromatic Region Short Arm UDSC & NCPGR Library SL_MboI0111D17 T1632 4 LE_HBa0261K11 Phase III C2-At1g60200 7 Phase I SL_EcoRI0086I08 Phase III 10 LE_HBa0042B19 cLET-8-B23 Phase I LE_HBa0189E17 11 T0564 LE_HBa0179E24 Phase II cLED-8-G3 15.5 Phase II SL_MboI0037H06 Heterochromatic Region Sequencing SL_MboI0095J08 Library LE_HBa0074A13 16 Phase III LE_HBa0058L13 T1592 LE_HBa0195M17 Sequencing Centromeric Region Library LE_HBa0051A18 LE_HBa0027B05 Phase II BS4 21 SL_EcoRI0053P22 Phase I Heterochromatic Region LE_HBa0169M21 T1360 73 Phase I Long Arm Phase I LE_HBa0334K22 cLEX-13-G5 79 T1746 84 LE_HBa0227B07 Library NRCPB LE_HBa0166A02 T1777 105 Phase I Phase II LE_HBa0168B11 107 T1541 Euchromatic Region Phase I LE_HBa0040C21 LE_HBa0131D04 T1584 108 Phase II Phase I LE_HBa0108A18 TG69 111 Phase II LE_HBa0006N20 LE_HBa0239D11 CT130 115 Phase II Phase II LE_HBa0245E05 TG597 119 Telomeric Region TG185 119 Phase II LE_HBa0251J13

  9. BACs mapped on chromosome 7 Chromosome 7 SP6 SP6 SP6 SP6 T7 HBa0144B20 HBa0123J08 HBa0064M20 HBa0102G23 HBa0188L22 SP6 Primer pair 1 ~1.4 kb overlap SP6 Primer pair 2 ~3.5 kb overlap T7 T7 T7 T7 MboI0077G20 (92 kb) SP6 T1401 (COS) 95 cM Primer pair 1 12955 bp overlap (100%) CT223 (RFLP) T7 HBa0179K09 (108 kb) T7 Primer pair 1 9002 bp overlap (100%) Clones sequenced to Phase III level T7 Clones sequenced to Phase II level MboI0032F07 (~140 kb) SP6 Extension clones verified T7 Red bars indicate the PCR positive nature of BAC clones using respective primer pairs ~19 kb overlap Primer pair 2 ~15.5 kb overlap Primer pair 1 SP6 Dotted line indicates the expected overlap MboI0052O23 MboI0083J01 Green line shows the presence of mapped markers on the BAC clones SP6 T7

  10. Gene prediction & annotation of some sequenced BAC clones

  11. Important genes present on some BAC clones

  12. Summary 1. Twenty two seed BAC clones using 20 markers have been confirmed 2. Nine extension BAC clones from 6 nucleation points have been confirmed 3. Finally, 31 BAC clones, covering approximately ~3.0 Mb region, have been mapped 4. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 5. Sequencing status of 25 BAC clones * Three BAC clones submitted to SGN/NCBI * One BAC clones in phase III (quality improvement) * Twelve BAC clones in phase II (10 submitted to NCBI) * Nine BAC clones in phase I 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI

More Related