slide1
Download
Skip this Video
Download Presentation
Question:

Loading in 2 Seconds...

play fullscreen
1 / 72

Question: - PowerPoint PPT Presentation


  • 74 Views
  • Uploaded on

Question:. How do we know where a particular protein is located in the cell?. Cell with fluorescent molecule. Principle of Fluorescence. Experimental Approaches for Protein Localization. 1. Small Molecule Dyes (e.g. DAPI). 2. Immunostaining (dye-conjugated antibodies).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Question:' - ray


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2
Question:

How do we know where a particular protein

is located in the cell?

slide3
Cell with

fluorescent molecule

Principle of Fluorescence

slide4
Experimental Approaches

for Protein Localization

1. Small Molecule Dyes (e.g. DAPI)

2. Immunostaining (dye-conjugated antibodies)

3. Green Fluorescent Protein (GFP) “Tagging”

slide7
GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)

slide8
Gene Expression

DNA (Gene X)

Transcription

mRNA

Translation

Protein X

slide9
Transcription

Translation

GFP Tagging Approach

DNA (Gene X -GFP “Fusion”)

mRNA

Protein X-GFP “Fusion”

slide10
GFP Tagging Experiments

Nuclei

Mitotic Spindle

Tubulin-GFP

Histone-GFP

slide11
Question:

Where is the Cdc10 protein located

in a yeast cell?

slide13
Transcription

Translation

GFP Tagging Approach

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”

slide14
Project Overview

Isolation of CDC10 gene Open Reading Frame

Purification of Genomic DNA from yeast

Polymerase Chain Reaction (PCR)

Construction of CDC10-GFP “fusion” gene

Restriction endonuclease/Ligase

Cloning DNA in E. coli

Introduction of CDC10-GFP “fusion” gene

into yeast cells

Observe Cdc10 protein localization

in living cells with fluorescence microscopy

slide15
Transcription

Translation

GFP Tagging of Cdc10

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”

slide16
Saccharomyces cerevisiae (Yeast)

Eukaryotic cell

15 million bp DNA

~ 6000 genes

Complete genome sequence known!

slide17
Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350

slide18
Taq DNA

Polymerase

slide19
Primer

DNA Synthesis

Pg. 202

slide20
CDC10 Gene Primers

CDC10-Forward

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Reverse

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’

slide21
CDC10 Gene

Sequence

(non-template strand sequence)

slide22
First Cycle of PCR

5’

3’

Rev

CDC10

3’

5’

5’

3’

(52o C.)

(94o C.)

(72o C.)

For

5’

3’

Pg. 349

slide26
Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350

slide27
Agarose

Gelidium comeum (kelp)

slide29
Lab #1

Purify genomic DNA

15 million bp

~ 6500 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350

slide32
3’

3’

5’

5’

5’

3’

5’

3’

Restriction Endonuclease Reaction

3’

5’

3’

5’

HindIII (37o C.)

slide33
DNA Ligase + ATP (15o C.)

3’

5’

3’

3’

5’

5’

3’

5’

5’

3’

5’

3’

HindIII recognition site is reconstituted

Ligation Reaction

“Compatible” ends

1. Annealing

2. Phosphodiester

bond formation

slide34
Construction of a

Recombinant DNA Plasmid

(insert)

Pg. 344

slide35
CDC10 Gene Primers

CDC10-For

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Rev

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’

slide36
GTGGTGAAGCTTATGTCCATCGAAGAA

CACCACTTCGAATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAAAGCTTCACCAC

TGACGACGACGATCTTTCGAAGTGGTG

3’

3’

5’

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

CDC10 ORF DNA from PCR

HindIII

slide37
Ori

AmpR

pGFP Plasmid

HindIII

slide38
Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf

slide39
ACT1p

CDC10 orf

GFP orf

HindIII

HindIII

- Thr - Ala - Ala - Ala - Arg - Lys - Leu - Met - Ser - Lys - Gly -

Cdc10

GFP

pCDC10-GFP Plasmid

HindIII Site

ACT GCT GCT GCT AGA AAG CTTATG TCT AAA GGT

5’

3’

slide40
DNA Cloning

Bacterial Transformation

(Lab #5)

pCDC10-GFP

Plasmid

Purification (Lab #5)

(AmpR)

(Ampicillin sensitive)

(LB growth medium

with ampicillin)

Pg. 344

slide41
DNA Cloning

Plasmid

Purification (Lab #6)

(AmpR)

(LB growth medium

with ampicillin)

Pg. 344

slide42
Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf

slide44
Ori

AmpR

pGFP Plasmid

HindIII

slide45
DNA Cloning

pCDC10-GFP

(LB-amp)

(AmpR)

(Ampicillin sensitive)

(LB-amp Plate)

Pg. 344

slide46
Transformation of E. Coli

Log Phase Growth

Cold (4oC)

CaCl2

plasmid

slide47
E. Coli

Cell Wall

Cell

Membrane

Cytoplasm

(chromosome, plasmids)

slide48
Ori

AmpR

pCDCGFP Plasmid

CDC10GFP

HindIII

HindIII

slide49
1000 bp

Morning section

slide50
1000 bp

Afternoon section

slide52
Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

Selectable

Marker

“Targeting”

sequence

slide53
Yeast Chromosome

Chromosome Integration

“Targeting” Locus (RPS10)

slide54
Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

StuI

slide55
ACT1p-CDC10GFP

URA3

Linear pCDC10GFP Plasmid

RPS10

RPS10

slide56
ACT1p-CDC10GFP

URA3

Yeast Chromosome

Chromosome Integration

Linear pCDCGFP

Plasmid

RPS10

slide57
ACT1p-CDC10GFP

URA3

Chromosome Integration

Yeast Chromosome with

CDC10-GFP and URA3 Genes!

slide58
URA3 Gene Encodes

Orotidine Decarboxylase

Orotidine Decarboxylase

Uridine Monophosphate

Orotidine Monophosphate

(RNA synthesis)

slide59
Yeast ura3 Mutant

Orotidine Decarboxylase

ura3 mutant can NOT make

Uridine Monophosphate

Orotidine Monophosphate

slide60
Question:

Where is the Cdc10 protein located

in a yeast cell?

slide61
Lab #9

Yeast Transformation Plate

Cells with the

CDC10GFP

“fusion” Gene

URA3 Transformants

slide62
ACT1p CDC10GFP

Expression of CDC10GFP “Fusion” Gene

Integrated in

Yeast Chromosome

Transcription/RNA Processing (nucleus)

mRNA (CDC10-GFP orf)

AAAAAA

G

Translation (cytosol)

Cdc10-GFP Protein

Observe Localization of Cdc10-GFP in Yeast Cells

slide64
Light Microscope

(10X)

(10-100X)

slide65
GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)

slide66
490 nm

510 nm

slide68
Septin Proteins of Yeast

*

Lipid Bilayer

Binding Domain

http://en.wikipedia.org/wiki/Septins

slide71
G2

Yeast Mitotic Cell Cycle

~ 3 Hours

slide72
G2

Cdc10 Protein in the

Yeast Mitotic Cell Cycle

Cdc10 marks

site of bud

formation

Cdc10 ring at

the mother/bud

neck

Cdc10 ring

splits into

two

Cdc10

De-polymerizes

ad