ravi
Uploaded by
32 SLIDES
721 VIEWS
380LIKES

Tutorial 11

DESCRIPTION

Tutorial 11. RNA Structure Prediction. RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan – microRNA prediction. RNA secondary structure types. Rfam. http://rfam.sanger.ac.uk/.

1 / 32

Download Presentation

Tutorial 11

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Tutorial 11 RNA Structure Prediction

  2. RNA Structure Prediction • Rfam – RNA structures database • RNAfold – RNA secondary structure prediction • tRNAscan – tRNA prediction • TargetScan – microRNA prediction

  3. RNA secondary structure types

  4. Rfam http://rfam.sanger.ac.uk/ • The Rfam database is a collection of RNA families, each represented by multiple sequence alignments andconsensus secondary structures.

  5. Rfam http://rfam.sanger.ac.uk/ Different search modes

  6. Search Rfam

  7. The secondary structure

  8. Structure representations :::::: free extremes ((())) Stem <<<>>> Internal Stem ______ Loop ,,,,,, Internal loop

  9. RNA secondary structure prediction GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA

  10. RNA structure prediction by Vienna RNA package RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences. RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment. RNAinverse server design RNA sequences for any desired target secondary structure.

  11. RNAfold • Gives best stabilized structure (structure with minimal free energy (MFE)) • uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule (partition function algorithm).

  12. RNAfold - input RNA sequence

  13. RNAfold - output Minimal free energy structure Sequence-Structure alignment Frequency of the structure Best “average” structure

  14. Graphic representation Coloring options

  15. Minimal free energy Mountain Plot centroid • A mountain plot represents a secondary structure in a plot of height versus position. • The height m(k) is given by the number of base pairs enclosing the base at position k. • Loops correspond to plateaus and stems correspond to slopes. • The closer the two curves, the better defined the structure. Folding Probabiliy Entropy

  16. RNAfold structure representations

  17. RNAalifold - input Alignment

  18. RNAalifold - output

  19. RNAinverse - input

  20. RNAinverse - output

  21. tRNAscan http://lowelab.ucsc.edu/tRNAscan-SE/ • Detection of tRNA genes in raw genomic sequence or • other types of sequence inputs.

  22. tRNAscan - input Sequence

  23. tRNAscan - results

  24. http://trna.nagahama-i-bio.ac.jp/

  25. MicroRNA - reminder

  26. Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs. • Find conserved 8mer and 7mer sites that match the seed region of each miRNA. • Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites

  27. Mir 31 - broadly conserved* microRNA * conserved across most vertebrates, usually to zebrafish

  28. Mir 136 - conserved* microRNA * conserved across most mammals, but usually not beyond placental mammals

More Related