1 / 44

GENETICS AND POLITICS

GENETICS AND POLITICS. Benedicte Callan Sid Richardson Fellow LBJ School, Center for Health and Social Policy. TALK OVERVIEW. The OECD Genetics & Genomics The controversies OECD “solutions”

quentin-branch
Download Presentation

GENETICS AND POLITICS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GENETICS AND POLITICS LBJ School, CHASP Benedicte Callan Sid Richardson Fellow LBJ School, Center for Health and Social Policy

  2. TALK OVERVIEW • The OECD • Genetics & Genomics • The controversies • OECD “solutions” • Under what conditions do countries establish international soft law for research and health policy? LBJ School, CHASP

  3. LBJ School, CHASP The Organisation for Economic Cooperation and Development’s 30 member countries

  4. MEMBER COUNTRIES • Meet in specialist committees and Ministerial level annual meetings to: • Share policy experience • Develop and publish comparable data • Identify principles of good governance • Do peer reviews of performance and policies • Agree multilateral instruments LBJ School, CHASP

  5. OECD STRUCTURE Council Oversight and strategic direction Representatives of member countries and of the European Commission Committees LBJ School, CHASP Secretariat Discussion and implementation Analysis and proposals Representatives of member countries and of countries with Observer status work with the OECD Secretariat on specific issues Secretary-General and Private Office Directorates Annual budget: 336 million euros funded by member countries

  6. BIOTECHNOLOGY UNIT • Committee on Scientific and Technology Policy • Working Group on Biotechnology • Task Force on Biomedicine an Health Innovation • Task Force on Industrial Biotechnology • Task Force on Biological Resource Centres Focuses on the application of advances in the life sciences to a variety of industrial sectors and their implications for society… LBJ School, CHASP

  7. OECD MINISTERIAL MANDATES in RESEARCH & HEALTH: • What policies will help capture the potential health benefits from genetics and genomics? • Can we do so while addressing the concerns of society about these new technologies. LBJ School, CHASP

  8. WHAT IS GENETICS AND GENOMICS? • Genetics • The roles and functions of single genes and variants • Genomics • The study of whole organism genomes: their sequence, genetic mapping, interactions between loci and alleles within the genome. • Pharmacogenomics • The use of genetic data to inform drug development and testing. An important application of pharmacogenomics is correlating individual genetic variation with drug responses. LBJ School, CHASP

  9. HUMAN GENOME PROJECT (1990-2003) • Genetic map: Polymorphic landmarks to trace inheritance • Physical map: Clones covering all chromosomal regions • Sequence: DNA sequence (3 billion bases) • Gene List: Identification of all genes 20-25,000 genes LBJ School, CHASP Information freely available without restriction From Eric Lander, June 2009

  10. SEQUENCING THE HUMAN GENOME • The Human Genome Project took 13 years and cost $3 billion • Recent costs of sequencing genome about $100 - 250,000 per genome • New techniques (SMRT, nanopores) bring costs closer to $50,000 and sequence time down • November 6 announcement of whole-genome sequences at cost of $4,400 • NIH push to deliver the >$1000 sequence, to allow personal sequence data to be used routinely in medical care LBJ School, CHASP

  11. Sequencing Output (currently 1-2 Gb per machine per day) 1,000,000,000 100,000,000 Single molecule? 10,000,000 1,000,000 Short-read sequencers 100,000 Kilobases per day per machine 10,000 Microwell pyrosequencing 200 Second-generation capillary sequencer Automated slab gel Manual slab gel 100 LBJ School, CHASP First-generation capillary 10 1980 1985 1990 1995 2000 2005 2010 Future Year Capillary sequencing Massively parallel sequencing Gel-based systems Slide from Eric Lander, data from MR Stratton et al. Nature458, 719-724 (2009)

  12. IDENTIFY GENES, VARIATIONS, EXPRESSION • Monogenic diseases – rare single gene disorders: Thalassaemia Sickle cell anemia Haemophilia Cystic Fibrosis Tay sachs disease Fragile X syndrome Huntington's disease… • Genetic tests available for about 1800 diseases • The accurate diagnosis of single-gene disorders and diseases has led, for example, to the development of screening programmes for cystic fibrosis and sickle cell anaemia in newborns. LBJ School, CHASP

  13. MULTIFACTORIAL DISEASES • Atherosclerosis, hypertension, obesity, diabetes, asthma, migraine, epilepsy, depression, bipolar disorder, autism, schizophrenia, multiple sclerosis, psoriasis, cancers and pathogenic infections • Complex diseases have a low heritability • Several to many genes may contribute • Environmental/lifestyle factors also contribute to risk LBJ School, CHASP

  14. FGFR2 TNRC9 MAP3K1 LSP1 8q24 CDKN2B/A 8q24 (n=6) ATG16L1 5p13 10q21 IRGMNKX2-3 IL12B 3p21 1q24 PTPN2 TCF2 CDKN2B/A IGF2BP2 CDKAL1 HHEX SLC30A8 TBL2 TRIB1 KCTD10 ANGLPT3 GRIN3A MEIS1 LBXCOR1 BTBD9 C3 8q24 ORMDL3 4q25 TCF2 GCKR FTO C12orf30 ERBB3 KIAA0350 CD226 16p13 PTPN2 SH2B3 ITGAM BLK HMGA2 GDF5-UQCC HMPG CRAC1 JAZF1 CDC123 ADAMTS9 THADA WSF1 LOXL1 GLUT9 L7R TRAF1/C5 STAT4 4q27 ABCG8 MLXIPL GALNT2 PSRC1 NCAN IBD5 NOD2 PPAR CTLA4 KCNJ11 PTPN22 2000 2001 2002 2003 2004 Confirmed genetic contributors to common human diseases(Dec 2007) Cholesterol Obesity Myocardial infarction QT interval Atrial Fibrilliation Type 2 Diabetes Prostate cancer Breast cancer Colon cancer Height Uric Acid Age Related Macular Degeneration Crohns Disease Type 1 Diabetes Systemic Lupus Erythematosus Asthma Restless leg syndrome Gallstone disease Multiple sclerosis Rheumatoid arthritis Glaucoma Celiac Disease NOS1AP IFIH1 PCSK9 CFB/C2 LOC387715 8q24 IL23R TCF7L2 LBJ School, CHASP CD25 IRF5 PCSK9 CFH 2005 2006 2007 Slide from Eric Lander

  15. ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTAATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATG CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGG ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACT TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATG ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTC ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTT CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGC ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCC ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTC GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGAT ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGC CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG Single Nucleotide Polymorphisms (SNPs): 1 heterozygous site per 1300 Most SNPs are common variants in population LBJ School, CHASP

  16. Human Genotyping: Major Technology Advances SNPs per assay 1997 1 2001 10 1,000 2004 50,000 500,000 2007 1,000,000 1998: POC 500-plex Slide from Eric Lander

  17. LBJ School, CHASP

  18. POLICY CHALLENGES: CIRCA 2000 • Tension between access to research results and commercial applications – open source & IPRs • Tension between research usage and privacy/security of personal genetic data • International collaboration in research and clinical diagnostics in absence of harmonisation of “regulatory” approaches • Uncertain receiving environment (regulatory & clinical) for new products • Need for meaningful public engagement LBJ School, CHASP

  19. ETHICAL, LEGAL & SOCIAL ISSUES – CIRCA 2010 • Access and use of genetic information • by insurers, employers, courts, researchers. • Privacy and confidentiality • Clinical issues • validation, appropriate use, interpretation, education/training • Personal Genomics • Direct to Consumer marketing of Genetic Information • Psychological impact and stigmatization of individuals and groups • Reproductive issues • IP/Commercialisation LBJ School, CHASP

  20. OECD EXPERT GROUPS CREATED TO: • Examine possible impacts of restrictive licensing practices for genetic inventions and policy options for avoiding these. • Develop internationally recognised and mutually compatible best practice policies for quality assurance of MGTs. • Develop guidance on privacy and security guidelinesto ensure adequate security of biobanks and genetic databases. • Exploration of economic and social impacts of pharmacogenetics. LBJ School, CHASP

  21. OECD Recommendations on: • 2006 -- Licensing practices for (patented) genetic inventions • 2007 – Quality of clinical (molecular) genetic tests • 2009 -- The privacy and security of biobanks and genetic databases LBJ School, CHASP

  22. OECD RECOMMENDATION ARE… • Instruments of the Organisation • Negotiated texts • Adopted by consensus, at whole of government level • Non-binding: a commitment on the part of member countries to make good faith efforts to implement • Often serve as “pre-law” for articulation of national legal instruments • An Acquis of the Organisation, such that new members must demonstrate they are willing and able to implement Instrument LBJ School, CHASP

  23. NEGOTIATION STAGES • Identification of issue (surveys, analytical reports, workshops) • Creation of government appointed “expert group” • Expert drafting of good practices • Agreement by countries to release draft “best practices” for public consultation • Expert redraft of “best practices” in light of comments • Substantive Committee agreement on draft Instrument • OECD Council Adoption of Recommendation LBJ School, CHASP

  24. THE PROBLEM WITH GENETIC INVENTIONS • Proliferation of gene patents -- genes, SNPs, ESTs -- was issue of concern for a variety of interest groups • Dependency problems, reluctance of researchers to enter fields where genes have already been patented or where multiple groups are competing to patent a same gene, restrictive licensing practices, royalty stacking, database access problems. • How frequently do these issues arise? What are the costs? LBJ School, CHASP

  25. COUNTRIES WANTED TO RESOLVE: • Do gene patents impede research, new product development, access to new products/services? • Do patents on genes need to be circumscribed, or is the research and clinical community adapting to the new environment with new strategies? • How can governments assure legitimate access to genetic information and distribute research results, funded by the public, so that they benefit the public. • What are the policy tools available to governments to reach this objective? LBJ School, CHASP

  26. WHAT WAS AT STAKE? • Harmonisation – or lack thereof – of global IP regime,(eg new exceptions to patentability) • Revenues for public research organisations • Biotech industry business model • Negotiation positions in other international organisations: • WTO • WIPO • WHO • Health care costs, quality and equity of access LBJ School, CHASP

  27. SURVEY OF PATENTS & CLINICAL GENETIC TESTING LABORATORIES • 65% offer genetic tests covered by patents recognized in the country • Patent has affected: - Cost of Test 70% - Number of Tests Performed 28% - Quality of the Test 20% • 10% of labs have ceased offering genetic test or tests that are covered by patent LBJ School, CHASP

  28. 2006 GUIDELINES FOR THE LICENSING OF GENETIC INVENTIONS • Set out principles and best practices for those in business, research and health systems who enter into license agreements for genetic inventions used for the purpose of human health care. • Foster the objectives of stimulating genetic research and innovation while maintaining appropriate access to health products and services. • [Change norms about the manner in which rights holders carry out licensing activities. • While maintaining legitimacy of patents for genetic inventions…] LBJ School, CHASP

  29. 1. GENERAL LICENSING • How to : ownership rights, collaborative research, confidentiality provisions… 1.1 License agreements should permit licensees to develop and further improve the licensed genetic inventions. 1.5 License agreements should not provide the licensor with exclusive control over human genetic information, including collections of such information, derived from individuals through the use of the licensed genetic invention. 1.6 Rights holders should be encouraged to agree to licensing terms and conditions that maximize the utilisation of their genetic inventions. Myriad DeCode LBJ School, CHASP Funding bodies

  30. 2. HEALTH CARE AND GENETIC INVENTIONS Myriad • 2.C Licensing practices should not be used to restrict the choice of other products or services by patients and their healthcare providers. • 2.D Licensing practices should encourage appropriate access to and use of genetic inventions to address unmet and urgent health needs in OECD member countries and non- member economies. Neglected diseases? LBJ School, CHASP

  31. 3. RESEARCH FREEDOM • 3.B Commercial considerations in public research activities should not unduly hinder the academic freedom of researchers. • 3.C Commercial considerations… should not unduly limit the ability to publish in a timely manner the results of research. • 3 D Commercial considerations in public research activities should not unduly limit the educational training of students. LBJ School, CHASP PRO policies and contracts w/private sector

  32. 4. COMMERCIALISATION Gene Chips 4.1 Should several licenses be required, license agreements should include a mechanism to set a reasonable overall royalty burden… 4.2 License agreements should… maintain low barriers for access to genetic inventions… [and] … not include [] excessive up-front fees. 4.3 License agreements should avoid reach-through rights…. 4.4 Private and public sector participants should develop mechanisms to decrease transaction costs in acquiring rights to use technology. Oncomouse LBJ School, CHASP Pools & Consortia

  33. WHAT WAS MISSED? • Definition of what sort of data or invention should be kept open? • SNPs data • GWAS • Contentious… • Conditions for patentability LBJ School, CHASP

  34. CREATION AND GOVERNANCE OF HUMAN GENETIC RESEARCH DATABASES • Research involving data and samples from human biobanks and genetic research databases analysed in conjunction with personal or health data is important for healthcare and drug discovery; • That research must respect the participants and be conducted in a manner that upholds human dignity, fundamental freedoms and human rights; LBJ School, CHASP

  35. BIOBANK EXAMPLES • UK Biobank – 60 million NHS patients • CARTaGENE – 20,000 Quebecois • GenomeEUtwin – 600,000 twin pairs • deCode, Iceland – >270,000 Icelandic citizens • 23andMe – maybe 6,000 paying customers • Kaiser Permanente -- 100,000 Northern Californians to be included ina genetic database: Research Program on Genes, Environment, & Health LBJ School, CHASP

  36. BIOBANKS: WHAT COUNTRIES WANTED • Guidance for the establishment, governance, management, operation, access, use and discontinuation of HBGRDs. • governance structure and oversight mechanisms; • privacy and confidentiality; • terms of participation; access; funding mechanisms; • benefit sharing, • intellectual property and commercialisation; • protection and security of human biological materials and data; • the qualifications, education and training of staff; • disposal of materials and data and the discontinuation of a HBGRD. LBJ School, CHASP

  37. BIOBANKS: WHAT IS AT STAKE? • Public Trust and participation in large scale genomic studies – public or private • Large scale research on genetic basis of health and disease • Privacy and security of personal health information • Public money – biobanks are subsidised and go bust LBJ School, CHASP

  38. 3. GOVERNANCE, MANAGEMENT, AND OVERSIGHT 3.A The HBGRD should be governed by the principles of transparency and accountability.   3.B The operators of the HBGRD should clearly formulate its governance structure and the responsibilities of its management and should make such information publicly available. 3.C The governance structure should be designed to ensure that the rights and well-being of the participants prevail over the research interests of the operators and users of the HBGRD. 3.D The… should have in place oversight mechanisms to ensure that… comply with legal requirements and ethical principles. LBJ School, CHASP

  39. 4. TERMS OF PARTICIPATION • 4.A Participant recruitment should be carried out in a non-coercive and equitable manner that respects individual freedom of choice. • 4.B Prior, free and informed consent should be obtained from each participant. • 4.C The operators of the HBGRD should give careful consideration to any special issues related to the participation of vulnerable populations or groups, and their involvement should be subject to protective conditions ... • 4.D …should have a clearly articulated policy on whether participants may be re-contacted [and] the situations for which re-contact will be permitted... Consent for new research LBJ School, CHASP DTC consumer

  40. 7. ACCESS • 7.A Access to human biological materials and data should be based on objective and clearly articulated criteria, and should be consistent with the participants’ informed consent. • 7.D Researchers should only have access to human biological materials or data that are coded or anonymised, such that the participant cannot be identified, and researchers should be required to not attempt to re-identify participants. .. • 7.8 The operators of the HBGRD should formulate policies and procedures setting out the manner in which an individual participant can request information and data about him/herself contained in the HBGRD, how those requests will be handled, and which information and data, if any, can be made available. LBJ School, CHASP

  41. 9. CUSTODIANSHIP, BENEFIT-SHARING AND INTELLECTUAL PROPERTY • 9.B Benefits arising from research using the HBGRD’s resources should be shared as broadly as possible, including by the sharing of information, licensing, or transferring of technology or materials. • 9.C The… HBGRD should have a clearly articulated policy and explicitly indicate to participants whether they and/or the HBGRD retain any rights over the human biological materials and/or data and the nature of such rights.   • 9.D The… HBGRD should have a clearly articulated policy… relating to the commercialisation of its own resources, research results derived from those resources, and/or commercial products, if any, that may arise from research using its resources. LBJ School, CHASP

  42. WHAT IT MISSED? • Public willingness to participate in [commercial] biobanks in exchange for personal genetic data and “information” • Blurring of research and commercial databanks • Emerging norm of making personal genetic information “open” LBJ School, CHASP

  43. COMMON FEATURES OF TOPICS THAT ARE AMENDABLE TO INTERNATIONAL SOFTLAW • Confluence of research, and industry and governmental concern • A tangible and a specific problem to be solved • Existence of set of feasible solutions • Demand for inter-governmental action • “Lowest common denominator” approach – no country can insist on highest standard • Large country leadership • Needed for public legitimacy • Needed to pressure action domestically • Low/no cost – (e.g. no new infrastructures) • Implementation is local/national LBJ School, CHASP

  44. THANK YOU! LBJ School, CHASP Benedicte.Callan@austin.utexas.edu

More Related