Intelligent icons integrating lite weight data mining and visualization into gui operating systems
Download
1 / 19

Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems - PowerPoint PPT Presentation


  • 128 Views
  • Uploaded on

Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems. Eamonn Keogh Li Wei Xiaopeng Xi Stefano Lonardi Jin Shieh Scott Sirowy Computer Science & Engineering Dept. University of California – Riverside. Outline. Overview

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems' - prosper


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Intelligent icons integrating lite weight data mining and visualization into gui operating systems l.jpg

Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems

Eamonn Keogh Li Wei Xiaopeng Xi Stefano Lonardi Jin Shieh Scott Sirowy

Computer Science & Engineering Dept.University of California – Riverside


Outline l.jpg
Outline

  • Overview

  • An Example: DNA to Intelligent Icon

  • Icon Generation Algorithm

  • Experimental Evaluation

  • Conclusion

Eamonn, patent this idea!

Christos Faloutsos


Dataset kalpakis ecg l.jpg
Dataset Kalpakis_ECG

Icons in a traditional browser


Dataset kalpakis ecg4 l.jpg

normal9.txt

normal8.txt

normal5.txt

normal1.txt

normal10.txt

normal11.txt

normal15.txt

normal14.txt

normal13.txt

normal7.txt

normal2.txt

normal16.txt

normal18.txt

normal12.txt

normal4.txt

normal3.txt

normal17.txt

normal6.txt

Dataset Kalpakis_ECG

  • Suppose I magically..

  • Color the icons to somehow reflect the contents of the file.

  • Position the icons based on their colors/patterns


Slide5 l.jpg

TGGCCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACACAAAAACATTTCCCACTACTGCTGCCCGCGGGCTACCGGCCACCCCTGGCTCAGCCTGGCGAAGCCGCCCTTCATGGCCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACACAAAAACATTTCCCACTACTGCTGCCCGCGGGCTACCGGCCACCCCTGGCTCAGCCTGGCGAAGCCGCCCTTCA

Let us start with visualizing a special data type, DNA.

The DNA of two species…

Are they similar?

CCGTGCTAGGGCCACCTACCTTGGTCCGCCGCAAGCTCATCTGCGCGAACCAGAACGCCACCACCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCGACGATAAAGAAGAGAGTCGACCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACA


Slide6 l.jpg

CTGGCCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACACAAAAACATTTCCCACTACTGCTGCCCGCGGGCTACCGGCCACCCCTGGCTCAGCCTGGCGAAGCCGCCCTTCA

T

A

G

C

C

C

C

C

T

T

T

T

T

A

A

A

A

A

G

G

G

G

G

0.20

0.24

CCGTGCTAGGGCCACCTACCTTGGTCCGCCGCAAGCTCATCTGCGCGAACCAGAACGCCACCACCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCGACGATAAAGAAGAGAGTCGACCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACA

0.26

0.30


Slide7 l.jpg

CCTGGCCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACACAAAAACATTTCCCACTACTGCTGCCCGCGGGCTACCGGCCACCCCTGGCTCAGCCTGGCGAAGCCGCCCTTCA

CC

CC

CT

CT

CT

TC

TC

TC

TT

TT

TT

C

T

CA

CA

CA

CG

CG

CG

TA

TA

TA

TC

TC

TC

AC

AC

AC

AT

AT

AT

GC

GC

GC

GT

GT

GT

A

G

AA

AA

AA

AG

AG

AG

GA

GA

GA

GG

GG

GG

CC

CCC

CCC

CCC

CCC

CCT

CCT

CCT

CCT

CTC

CTC

CTC

CTC

CC

CC

CC

CC

CC

CC

CC

CT

CT

CT

CT

CT

CT

CT

CT

TC

TC

TC

TC

TC

TC

TC

TC

TT

TT

TT

TT

TT

TT

TT

TT

C

C

C

C

C

C

T

T

T

T

T

T

CCA

CCA

CCA

CCA

CCG

CCG

CCG

CCG

CTA

CTA

CTA

CTA

CAC

CAC

CAC

CAC

CAT

CAT

CAT

CAT

CA

CA

CA

CA

CA

CA

CA

CA

CG

CG

CG

CG

CG

CG

CG

CG

TA

TA

TA

TA

TA

TA

TA

TA

TC

TC

TG

TC

TG

TC

TC

TC

CAA

CAA

CAA

CAA

AC

AC

AC

AC

AC

AC

AC

AC

AT

AT

AT

AT

AT

AT

AT

AT

GC

GC

GC

GC

GC

GC

GC

GC

GT

GT

GT

GT

GT

GT

GT

GT

A

A

A

A

A

A

G

G

G

G

G

G

AA

AA

AA

AA

AA

AA

AA

AA

AG

AG

AG

AG

AG

AG

AG

AG

GA

GA

GA

GA

GA

GA

GA

GA

GG

GG

GG

GG

GG

GG

GG

GG

CCGTGCTAGGGCCACCTACCTTGGTCCGCCGCAAGCTCATCTGCGCGAACCAGAACGCCACCACCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCGACGATAAAGAAGAGAGTCGACCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACA


Slide8 l.jpg

0.04TGGCCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACACAAAAACATTTCCCACTACTGCTGCCCGCGGGCTACCGGCCACCCCTGGCTCAGCCTGGCGAAGCCGCCCTTCA

0.02

0.04

0.09

1

0.02

0.07

0.03

CA

CA

CA

CA

CA

CA

CA

CA

CA

CA

0.03

0.11

AC

AC

AC

AC

AC

AC

AC

AC

AC

AC

AT

AT

AT

AT

AT

AT

AT

AT

AT

AT

AA

AA

AA

AA

AA

AA

AA

AA

AA

AA

AG

AG

AG

AG

AG

AG

AG

AG

AG

AG

CCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACA

0


Slide9 l.jpg

OK. Given any DNA string I can make a colored bitmap, so what?

CCGTGCTAGGCCCCACCCCTACCTTGCAGTCCCCGCAAGCTCATCTGCGCGAACCAGAACGCCCACCACCCTTGGGTTGAAATTAAGGAGGCGGTTGGCAGCTTCCCAGGCGCACGTACCTGCGAATAAATAACTGTCCGCACAAGGAGCCCGACGATAGTCGACCCTCTCTAGTCACGACCTACACACAGAACCTGTGCTAGACGCCATGAGATAAGCTAACA


Slide10 l.jpg

Indian what?

rhinoceros.dna

white

rhinoceros.dna

rhesus

monkey.dna

pygmy

chimpanzee.dna

sperm

whale.dna

Indian

hippopotamus.dna

chimpanzee.dna

elephant.dna

Human.dna

African

orangutan.dna

elephant.dna

pygmy

sperm whale.dna

Indian

Indian

rhinoceros.dna

rhinoceros.dna

white

white

rhinoceros.dna

rhesus

rhesus

monkey.dna

monkey.dna

pygmy

pygmy

chimpanzee.dna

chimpanzee.dna

sperm

sperm

whale.dna

whale.dna

Indian

Indian

hippopotamus.dna

hippopotamus.dna

chimpanzee.dna

chimpanzee.dna

elephant.dna

elephant.dna

Human.dna

Human.dna

African

African

orangutan.dna

orangutan.dna

elephant.dna

elephant.dna

pygmy

pygmy

sperm whale.dna

sperm whale.dna


Slide11 l.jpg

Note what?Elephas maximus is the Indian Elephant, Loxodonta africana is the African elephant and Pan troglodytes is the chimpanzee.


Slide12 l.jpg

aa what?

ac

ca

cc

cd

ab

ad

cb

da

dc

bc

ba

dd

db

bd

bb

a

b

aaa

aab

aba

aac

aad

abc

c

d

aca

acb

acc

Can we make Intelligent Icons for time series?

Yes, with SAX!

accbabcdbcabdbcadbacbdbdcadbaacb…

c

c

c

b

b

b

a

a

Time Series Bitmap


Slide13 l.jpg

While they are all example of EEGs, what?example_a.dat is from a normal trace, whereas the others contain examples of spike-wave discharges.


Slide14 l.jpg

300 what?

One Year of Italian Power Demand

200

100

December

January

August

0

We can further enhance the time series bitmaps by arranging the thumbnails by “cluster”, instead of arranging by date, size, name etc

We can achieve this with MDS.

We can further enhance the time series bitmaps by arranging the thumbnails by “cluster”, instead of arranging by date, size, name etc

We can achieve this with MDS.

August.txt

July.txt

June.txt

April.txt

May.txt

Sept.txt

Oct.txt

Feb.txt

Dec.txt

March.txt

Nov.txt

Jan.txt


Text example l.jpg
Text Example what?

Here are some papers that reference Eamonn Keoghs work…


Text example16 l.jpg

Paper on using what?

Paper on using

“warping” to

“warping” to

classify

classify

Cluster of

Cluster of

classification papers

“classification” papers

Cluster of “warping” papers

Cluster of “warping” papers

Classification

Classification

paper in Italian

paper in Italian

“Warping” paper

“Warping” paper

in Portuguese

in Portuguese

Text Example



Paper summary l.jpg
Paper Summary what?

  • We show how to map DNA, time series and natural language into intelligent icons.

  • We give a generic framework for mapping any kind of data into intelligent icons.

  • We show the utility of intelligent icons for finding patterns (clusters, outliers etc)


Questions l.jpg
Questions? what?


ad