DNA and Genes

1. DNA and Genes

2. Things to find out: • What is DNA? • The Genetic Code • The Human Genome

3. Diversity of Life • All biological systems are composed of the same types of molecules • Similar organization principles are used at the cellular level

4. The Cell • Basic component of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus

5. Prokaryotes: no defined nucleus and a simplified internal structure • Eukaryotes: membrane limited nucleus and complicated internal structure • Three branches of life

6. Genetic material is located in nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains the information needed to build an individual

7. What is DNA needed for? • Genetic information is • transferred from DNA and • converted to protein • RNA molecules work as messengers • Proteins are the biological workers

8. Information of the DNA is copied to a RNA • molecule in transcription • RNA directs the protein synthesis in a translation • Protein’s 3D structure determines it’s function • Information transfer only in one direction

9. DNA (Deoxyribo Nucleic Acid) • a polymer of nucleotide monomers • 2’-deoxyribose sugar • Four bases: • Adenine, A • Guanine, G • Thymine, T • Cytosine, C Base part Sugar part

10. Purine bases Adenine and guanine Two carbon rings Pyrimidine bases Thymine and cytosine A single carbon ring Four bases...

11. DNA chains • Nucleotides are joined with phosphodiesteri bond • Sequence of bases vary  genetic information • Extremely long chains!

12. DNA Molecules • Two polynucleotide chains are joined • Double helix, twisted in right handed way • Full circle in every 10 bases

13. ”ladder-structure” • Bases = steps • Sugars and phosphates = supporting pilars • Two nucleotide chains run in opposite directions • chemical direction (5´-3´)

14. Complementary Pairing • Bases pair with other bases • Space between the chains is limited  Purines with two carbon rings pair only with single ring pyrimidines A + T G + C • Complementary pairing is vital for the use and storage of the genetic information! • Interaction is stabilized by hydrogen bonds

15. The Genetic Code • Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein)

16. The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons

17. Right reading frame is obligatory! • Part of the sequence from psoriasis associated gene HCR atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc • Three different reading frames can be used, but only one is the right one • Translate tools are found from the internet Frame 1 Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H The right one

18. Chromosome Condenced scaffold fibers connected to chromosome scaffold chromatin fibers chromatin DNA

19. Genes • A gene: DNA sequence that is needed to encode amino acid sequence of a protein • Composed of exons, introns and different control elements • Exon – protein coding sequence • Intron – intervening sequence

20. Genes vary a lot in size: • Humans: average 3000bp • largest 2.4 million bp • Genes are separated by sequences with unknown function • Only one strand of the DNA carries biological information  template strand • Potential to store biological information is enormous

21. That’s all for this time!

22. The Human Genome and Inheritance

23. The Human genome... The different types of sequences that make up the total DNA of a human cell • 3 billion base pairs • about 22 000 genes • Only 2 % of the DNA encode proteins • Genes include exons and introns • Beside coding areas also additional secuences are found • 50 % repeated sequences (”junk DNA”)

24. 23 chromosome pairs  46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX  female • XY  Male

25. Chromosomes carrying the same genes are called homologous

26. Mutations • Alterations in DNA sequence • Some are part of normal DNA variation • Caused by chemical and physiological agents • and errors in DNA replication • Cells can repaire some mistakes • If not repaired changes in DNA sequence • are made permanent by DNA replication

27. Point mutations: Single base mutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon

28. Frameshift mutations: • insertion/deletion • dublication • translocation • Altered reading frame • Severe impacts on protein structure

29. Passing on the genetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develop • Offspring recieve genes by inheriting chromosomes

30. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA Phenotypes Genotype Genotype GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG

31. All somatic cells • 23 chromosome pairs • (46 chromosomes) • Diploid cells, 2n Fertilization: + n n • Sperm cell • 23 chromosomes • Haploid cell, n • Egg cell • 23 chromosomes • Haploid cell, n • Fertilized egg • 2n • 46 chromosomes

32. A chromosome pare: • A locus • An allele

33. Mitosis • Division of somatic cells • Products two daughter cells from • one parent cell • The number of chromosomes • does not change • DNA duplicates before entering • the mitosis • Takes 1-2 hours

34. Meiosis • Only in gamete formation • One diploidic parent cell produces • four haploid gametosytes • Mature gametocytes have 23 • chromosomes (n)

35. Crossing over: • Chromatids change parts • between homologous chromatids • during the meiosis • Causes redistribution of heridary • material between the homologous • chromosomes •  number of genes doesn’t • change •  new allele combinations • are formed

37. Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from • a parent to a offspring • Monogenic diseases: disease is caused by one mutation in • one gene • Multifactiorial diseases: disease is caused by interaction • of different mutations and environmental factors • Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus

38. Dominant character: only one allele needed to cause the • phenotype (heterozygous) • Recessive character: both allels needed to cause the • phenotype (homozygous)

40. Autosomal dominant inheritance: Aa aa Aa aa Aa

41. Autosomal recessive inheritance: aa Aa aa Aa Aa aa aa Aa AA

42. X-chromosome linked recessive inheritance:

43. X-chromosome linked dominant inheritance: