480 likes | 608 Views
Explore the invasive slug species on the West Coast, identifying them based on DNA analysis. Learn about the morphology, families, and threats these slugs pose. Discover how to differentiate between various slug families using molecular techniques.
E N D
West coast slugs: faunal composition, diagnostic characters and future threats Rory Mc Donnell Department of Entomology, University of California, Riverside
Coming up! • Background information • What invasive slug families and species occur here? • How do we identify them? • DNA and identification • Conclusions
Background Information • Traditionally a repulsive organism • Slug phobias – American Journal of Clinical Hypnosis
Slugs as Pests • Direct pests of agriculture and horticulture • Human food = Gastropod food • Vectors of human pathogens • Aesthetic damage
External morphology Ocular tentacles Keel Mantle Pneumostome Caudal mucus pore Sensory tentacles Foot fringe
Genital morphology Body wall Oviduct Atrium Penis Bursa copulatrix duct Bursa copulatrix Vas deferens Flagellum Hermaphrodite duct
West coast slugs! • California – 34 slugs species (17 native) Ariolimax dolichophallus
The Invasive Fauna • 17 invasive species on the west coast Predominantly European
Family Testacellidae Testacella haliotidea
Family Veronicellidae Veronicella cubensis – Cuban Slug
Family Milacidae Milax gagates
Other Milacidae Tandonia budapestensis Boettgerilla pallens
Slug Identification • Breathing pore used to distinguish Arionidae from both Limacidae and Agriolimacidae Arionidae Agriolimacidae Limacidae
Agriolimacidae vs Limacidae Limacidae Agriolimacidae
Family Limacidae Lehmannia valentiana – Valentia Slug
Family Limacidae Limacus flavus – Cellar slug Limax maximus – Leopard slug
Family Agriolimacidae Deroceras reticulatum – Gray Garden Slug
Family Agriolimacidae Deroceras laeve Deroceras panormitanum Deroceras invadens
Deroceras panormitanum Deroceras laeve Deroceras invadens
Family Arionidae How to identify an Arion? • Family contains many species complexes • Arion circumscriptus, distinctus, hortensis, intermedius, silvaticus, subfuscus and rufus
Family Arionidae Arion intermedius
Family Arionidae Arion rufus
Arion rufus Arion ater Arion vulgaris (= lusitanicus)
Arion subfuscus Arion subfuscus – Dusky Slug
Arion fuscus Arion subfuscus
Arion hortensis complex • Three species – Arion hortensis, distinctus and owenii Arion hortensis Arion distinctus
Arion distinctus Arion hortensis 2mm 2mm • Epiphallus structure – structure associated with outlet of epiphallus in atrium • Backeljau and Van Beeck (1987)
Arion fasciatus complex • Arion fasciatus, silvaticus and circumscriptus Arion silvaticus
Arion silvaticus Arion circumsciptus Arion fasciatus
Slug Identification • Taxonomically challenging e.g.Arion • External morphological features (e.g. color) are unreliable • Internal morphological structures (e.g. genitalia) can also be unreliable Could we use DNA to design a molecular identification key for slugs?
Methods and Materials • DNA extraction using Qiagen Extraction Kit • Amplification of a 655bp fragment of COI using PCR (Polymerase Chain Reaction) • Fragment cleaning and sequencing (GATC, Germany) • Restriction enzymes and gel electrophoresis
Restriction enzymes • Break sequences into differently sized fragments based on their composition. • Restriction enzyme X cleaves at GTCA Species A …GCTAGTCATAGATTGCCAAGC... Species B …GCTAGTCATAGAGTCACAAGC… • For larger sequences the post-digestion fragments are visible on a standard agarose gel
Molecular Identification Key 1. AccI does not fragment sequence ………………………….…………………………..….2 AccI fragments sequence into at least 2 parts.....…………...…….……………...…..….4 2. EarI cuts sequence into 2 or more parts; largest post-digestion band <600bp ……....3 EarI does not fragment sequence; largest post-digestion band at 706bp ……………………………………………………………..…………………...A. subfuscus 3. Largest EarI post-digestion band >500bp …………...………………...……A. distinctus Largest EarI post-digestion band <500bp ………………...………..….…A. intermedius 4. BstUI cuts sequence into 2 parts ………………..………………..………….A. silvaticus BstUI does not cut sequence; single post-digestion band at 706bp ……….…………..5 5. Largest BfaI post-digestion band <700bp …………..……………………..……. A. rufus Largest BfaI post-digestion band >700bp ……………..……….……….….A. hortensis
1. Enzyme AccI does not fragment sequence……………….………………………...… 2 Enzyme AccI fragments sequence into at least 2 parts.......………………...…..…..4
4. BstUI cuts sequence into 2 bands …………………..……………….......A. silvaticus BstUI does not cut sequence; single post-digestion band at 706bp …………….5
5. Largest BfaI post-digestion band <700 bp………………………………….A. rufus Largest BfaI post-digestion band >700 bp ………………..…..….…. A. hortensis Species is Arion rufus
1. Enzyme AccI does not fragment sequence……………….………………………..… 2 Enzyme AccI fragments sequence into at least 2 parts.......………………...…..…..4
4. BstUI cuts sequence into 2 bands …………………………………….......A. silvaticus BstUI does not cut sequence; single post-digestion band at 706bp …………….5 500bp 100bp Species is Arion silvaticus
Conclusions • 17 invasive slug species on west coast • Knowledge of genital morphology is important • Species to be vigilant for: • Any leatherback slug • Arion vulgaris • Tandonia budapestensis • DNA can be used for accurate identifications
Acknowledgements • Roy Anderson, Kurt Jordaens and Michal Manas for permission to use images • Marie Curie Outgoing International Fellowship David Yoo Sarinah Simmons