LECTURE 32: Classification and taxonomy of RNA viruses

1. LECTURE 32: Classification and taxonomy of RNA viruses By Randall Fisher B.Sc. MBS 2355827@uwc.ac.za

2. Classification of RNA Viruses • Classification or Characterization: • noun:   the act of describing distinctive characteristics or essential features. • WHY?

4. BUT WHY LARRY WHY???

5. Structure of this lecture • Intro to RNA Viruses • Structure of RNA inside the virus • Size (Does matter) • Circular / Linear • Single / Double • Positive / Negative sense • Segmentation • Mutations • Abnormalities • 8 Examples of RNA Viruses

6. Intro to RNA viruses • Consist of RNA and not DNA • Stability?

7. Genomic Size • Largest RNA Viral genomes: 30 000nt • Largest DNA viral genome: 300 000nt

8. Genomic organization • DNA: • RNA:

9. 5’ ATG 3’ 3’ UAC 5’ UAC 3’ 5’ Genomic orientation • Positive sense • Negative sense

10. Genomic segmentation DNA RNA

11. Genomic mutations ds DNA

12. Genomic mutation Viral ss RNA No Checking!!!

13. 5’ 3’ 5’ 3’ Genomic Abnormalities • 5’ abnormalities • 3’ abnormalities AAAAAAAAAAAAAAAAAAAA Poly-A-Tail ATATATGCGCGCCGCGCGTATATA

14. RNA Viruses

15. Orthomyxoviruses • From the Greek ‘orhto’ = excess water + ’myxa’ = mucus (i.e: snot) • Enveloped virion containing non-segmented, ss RNA (-) ~13.6kb • 3 clinically important subfamilies: • Influenza A • Most pathogenic to man • Causes major pandemics and epidemics • 15 known haemagglutinin (H) serotypes and 9 known neuraminidase (N) serotypes (E.g.: H5N1 or Bird-flu) • Influenza B • Not a sever infection • No distinguishable serotypes • Wait for it… • Influenza C • Serologically different to types A and B

16. Orthomyxoviruses Structure

17. Paramyxoviruses • From the Greek “para” = by the And “myxa” = mucus • Non-segmented, ssRNA (-) ~ 20kb • Causes measles, mumps, and Para influenza • -’ve sense Viral RNA is converted into +’ve sense mRNA by host cell machinery during viral replication

18. Paramyxoviruses

19. Togaviruses • Enveloped virion containing non-segmented, ssRNA (both + an – sense) ~11.7kb • Subspecies (i.e.: Rubella virus) causes Rubella or German Measles • Symptoms include low grade fever,sore throat, rash, and lymphoadenopathy • Viral RNA is complimented by the host cells machinery and the –’ve sense strand produced serves as a template for more +’ve sense strands

20. Toga viruses

21. Retroviruses • Spherical, Enveloped, 2X ssRNA (+) ~ 11kb • Virion contains a reverse transcriptase enzyme • Creates circular DNA of viral RNA • Integrates into hosts DNA • Host remains chronically infected • Wide variety of symptoms • Yes, this is the one that causes AIDS

22. Retroviruses

23. Rhabdoviruses • Spiked, enveloped, bullet shaped virus • Non-segmented, ssRNA (-) ~16kb • Family of viruses that causes Rabies

24. Rhabdoviruses

25. Reoviruses • Non-enveloped with short spikes • Segmented, dsRNA ~ Total size is 27kb • During replication in the host cytoplasm, segments are readily resorted • Examples include Rotaviruses which is known to cause gastroenteritis

27. Reoviruses

28. Picornaviruses • Non-segmented, ssRNA (+) ~ 8.4kb • Most common Picornaviruses are: • Enteroviruses – polio, coxsackie and echoviruses • Rhinoviruses – causes rhinitis (common cold) • Hepatoviruses – Hepatitis A • Also infects animals resulting in foot and mouth disease

29. Picornaviruses

30. Picornaviruses

31. Coronaviruses • Enveloped, spiked virion • Non-segmented, ssRNA (+) ~ 30kb • Infects a wide variety of animal hosts • Cause mild upper respiratory infections in humans • Recently, SARS Coronavirus was discovered (2003) • Later, NL63 Coronavirus was discovered

32. Coronaviruses

33. Coronaviruses