10 likes | 94 Views
Putative integration sites for the lvh-containing mobile element. Sequence of tRNA-Pro gene aligned with 77 bp DNA fragments flanking the lvh locus using CLUSTAL_W. Identical residues marked below the alignment by "*". The 45 bp of the 3' end of tRNA-Pro gene identical to both repeats enclosed within a rectangle.
E N D
tRNA-Pro 1267202 CGGGGCGTAGCGCAGCCTGGTAGCGTACTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1267126 repeat-1 1222166 TTTGAAATTGAATGAAATGGGTTGTTATTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1222090 repeat-2 1185492 AAGTTAATACTTTAAATATTGATAGCAAGAGGATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1185416 * * ** ********************************************* Figure S3. Putative integration sites for the lvh–containing mobile element Sequence of the tRNA-Pro gene is aligned with the sequences of the 77 bp DNA fragments that flank the lvh locus using CLUSTAL_W. Identical residues are marked below the alignment by “*.” The 45 bp of the 3’ end of the tRNAPro gene that are 100% identical to both repeats are enclosed within a rectangle.