190 likes | 333 Views
Our Test Organism. Drosophila simulans. Trait of Interest. Red vs. White. What did we do in lab 1?. Vial of 5 white-eyed females Vial of 6 males, 5 white-eyed With ONE red-eyed male mixed in What is p(red-eye allele)? 1/11 What did we say about the fitness of the red-eyed mutant?
E N D
Our Test Organism Drosophila simulans
Trait of Interest Red vs. White
What did we do in lab 1? • Vial of 5 white-eyed females • Vial of 6 males, 5 white-eyed • With ONE red-eyed male mixed in • What is p(red-eye allele)? • 1/11 • What did we say about the fitness of the red-eyed mutant? • Sensory perception • Should be more fit because has better vision • White eyes = reduced mate tracking
What should we expect to see? • More or less red-eyed flies? • So we have an adaptive allele (red-eyed mutation)… • Should increase in frequency.. What is this called? • Selective sweep • What about polymorphisms located near it? • Hitchhiking • How can we tell if a sweep and hitchhiking has happened?
Genotype the flies near that gene! • Need to first get DNA from the flies (DNA Isolation) • Squish flies to release all their DNA • Need to look at polymorphisms near that gene • Polymerase Chain Reaction • Amplify the DNA of interest enough so we can look at it on a gel Ahhh! Help meeeeeee
Drosophila chromosome What are we going to look at? • Two markers on X-chromosome • One close to the gene for white eyes • One far from the gene for white eyes • Why are we going to look at 2 markers? Red / White eye color gene 22 million bases of DNA 22 million bases of DNA “Near” “Far”
Polymorphisms Recombination Hotspot! • Red: gene mutated to give flies red-eyes • Blue: indel polymorphism • What is an indel polymorphism? • NEAR marker • Yellow: indel polymorphism • FAR marker
Recombination Hotspot! • Who is linked to the red gene? • Blue or yellow? • Say that 1 red-eyed male in the first lab had: • Insertion at the near marker (blue) • Deletion at the far marker (yellow) • All white-eyed individuals had: • Deletion at the near marker (blue) • Insertion at the far marker (yellow) • What will our flies today look like at each marker?
Hypothesis • As chromosomes are passed down over generations, they sometimes “trade pieces” with other chromosomes... (recombination) • More likely to keep the same close neighbor gene variants than far away neighbors. • If natural selection makes one variant spread quickly, itsclose neighbor variants may also spread. This is called genetic hitchhiking
Selective Sweep (positive directional selection) Advantageous mutation # sites # sites 1 2 3 4 1 2 3 4 Frequency in sample Frequency in sample
Before sweep After sweep Selective Sweep/Hitchhiking This is one chromosome from 12 different people. The different colors represent different alleles for that gene. What happened?
Selective Sweep/Hitchhiking If a mutation is advantageous it will likely increase in frequency Why? What will happen to genes/traits that are closely linked to the advantageous mutation? What will happen to genes/traits that are not closely linked to the advantageous mutation?
Variation at 3 loci • 2 variants at the eye color gene • Red & White alleles • 2 variants at the Near marker • High and Low • The red-eyed male from Day 1 has the high allele at Near • The white eyed flies had both variants • 2 variants at the Far marker • High and Low • The red-eyed male from Day 1 has the low allele at Far • The white eyed flies had both variants
How are we going to observe & measure genetic variation? - Microsatellite Markers - Sequence differences (aka variation) between alleles Usually base pair repeats, insertions, or deletions Used for between & within-species comparisons
“Genetic markers” Reference point in the genome with 2+ alleles • A sequence: • AACATGGTGACGGCTAGCA • a sequence: AACATGGTGAGAGAGACGGCTAGCA High allele Low allele
How to tell males from females • Males have black abdomens • Look close at the tip of the male abdomen and you will see his junk • Females have rounded abdomens Female Male
White male Red female White female Red male Sexing your flies: males have a “black butt”, females have large white abdomen
Sexing Female Male
A note about contamination • DO NOT CONTAMINATE YOUR DNA ISOLATIONS! • Change tips in between EACH fly squish! • Just because you can’t see the DNA on the tip, doesn’t mean it’s not there!