slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris PowerPoint Presentation
Download Presentation
Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris

Loading in 2 Seconds...

  share
play fullscreen
1 / 7
orlando-farrell

Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris - PowerPoint PPT Presentation

0 Views
Download Presentation
Vandenbussche Frank, Lefebvre David , De Leeuw Ilse, De Clercq Kris
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. LABORATORY VALIDATION OF TWO REAL TIME RT-PCR METHODS FOR FOOT-AND-MOUTH DISEASE VIRUS WITH AN INCREASED DIAGNOSTIC SPECIFICITY Vandenbussche Frank, Lefebvre David, De Leeuw Ilse, De Clercq Kris 22 October 2015 GFRA Scientific Meeting, Hanoi, Vietnam

  2. Introduction: rRT-PCR for FMDV • 5’-UTR rRT-PCR

  3. Introduction: rRT-PCR for FMDV • 3D rRT-PCR Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney KL, Rock DL, Nelson WM. J Am Vet Med Assoc. 2002 Jun 1;220(11):1636-42. • Evaluation of the 5’-UTR and 3D rRT-PCRs

  4. Validation of the 5’-UTR and 3D rRT-PCRs at CODA-CERVA (ISO 17025 accreditation) • Excellent results for each assay for: • Analytical sensitivity and specificity • Repeatability and reproducibility • Linearity of the PCR • Diagnostic sensitivity and specificity using reference samples • Field samples negative for FMDV: regularly Cp 38-45 (doubtful result)

  5. General principle demonstrated for the FMDV 3D forward primer 5’-ATATATATATATACTGGGTTTTACAAACCTGTGA … ..............TGACCCAAAATGTTTGGACACT… ATATATATATATACTGGGTTTTACAAACCTGTGA………………….. TATATATATATATGACCCAAAATGTTTGGACACT… ATATATATATATACTGGGTTTTACAAACCTGTGA………………….. ATATATATATATACTGGGTTTTACAAACCTGTGA … TATATATATATATGACCCAAAATGTTTGGACACT…

  6. Results for the diagnostic specificity using field samples • Negative sheep serum (N=382) • Negative cattle serum (N=372) • Negative pig serum (N=372) • 1 of the 1126 negative samples yielded a false-positive test result in the 3D/IC/EC rRT-PCR (Cp 39.78) with the cut-off value for positive set at Cp 40. • No false-positive test result was observed in the 5’-UTR/ IC/EC rRT-PCR. • No doubtful test results (Cp 40-50) were observed in neither of the two rRT-PCRs.